Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference |
Identifiers | Additional information |
|---|---|---|---|---|
| strain, strain background (Escherichia coli) | MC4100 | Casadaban and Cohen, 1979 | ||
| strain, strain background (E. coli) | MC1061 | Casadaban and Cohen, 1980 | ||
| strain, strain background (E. coli) | J1M1 | Sargent et al., 1998 | MC4100 ΔtatE | |
| strain, strain background (E. coli) | JARV16 | Sargent et al., 1999 | MC4100 ΔtatA ΔtatE | |
| strain, strain background (E. coli) | ELV16 | Sargent et al., 1999 | MC4100 ΔtatA | |
| strain, strain background (E. coli) | DADE | Wexler et al., 2000 | MC4100 ΔtatABCD ΔtatE | |
| strain, strain background (E. coli) | MΔABC | Alcock et al., 2013 | MC4100 ΔtatABC::apra | |
| strain, strain background (E. coli) | JARV16 λA D31K | This paper | JARV16 attB::PtatAtatAD31K (kanr) | |
| strain, strain background (E. coli) | JARV16 λA K49D | This paper | JARV16 attB::PtatAtatAK49D (kanr) | |
| strain, strain background (E. coli) | JARV16 λA D31K/K49D | This paper | JARV16 attB::PtatAtatAD31K,K49D (kanr) | |
| strain, strain background (E. coli) | JARV16 λA K52D | This paper | JARV16 attB::PtatAtatAK52D (kanr) | |
| strain, strain background (E. coli) | JARV16 λA D31K/K52D | This paper | JARV16 attB::PtatAtatAD31K,K52D (kanr) | |
| strain, strain background (E. coli) | JARV16 λA EDD | This paper | JARV16 attB::PtatAtatAK37E,K40D,K41D (kanr) | |
| strain, strain background (E. coli) | JARV16 λA KKK | This paper | JARV16 attB::PtatAtatAD45K,D46K,E47K (kanr) | |
| strain, strain background (E. coli) | JARV16 λA EDD/KKK | This paper | JARV16 attB::PtatAtatAK37E,K40D,K41D,D45K,D46K,E47K (kanr) | |
| strain, strain background (E. coli) | JARV16 λAry | This paper | JARV16 attB::PtatAtatA-EAK-eyfpA206K (kanr) | |
| strain, strain background (E. coli) | JARV16 λAry D31K | This paper | JARV16 attB::PtatAtatAD31K-EAK-eyfpA206K (kanr) | |
| strain, strain background (E. coli) | JARV16 λAry K49D | This paper | JARV16 attB::PtatAtatAK49D-EAK-eyfpA206K (kanr) | |
| strain, strain background (E. coli) | JARV16 λAry K52D | This paper | JARV16 attB::PtatAtatAK52D-EAK-eyfpA206K (kanr) | |
| strain, strain background (E. coli) | JARV16 λAry EDD | This paper | JARV16 attB::PtatAtatA K37E,K40D,K41D-EAK-eyfpA206K (kanr) | |
| strain, strain background (E. coli) | JARV16 λAry KKK | This paper | JARV16 attB::PtatAtatA D45K,D46K,E47K-EAK-eyfpA206K (kanr) | |
| strain, strain background (E. coli) | ELV16 λAry D31K | This paper | ELV16 attB::PtatAtatAD31K-EAK-eyfpA206K (kanr) | |
| strain, strain background (E. coli) | ELV16 λAry K49D | This paper | ELV16 attB::PtatAtatAK49D-EAK-eyfpA206K (kanr) | |
| strain, strain background (E. coli) | ELV16 λAry K52D | This paper | ELV16 attB::PtatAtatAK52D-EAK-eyfpA206K (kanr) | |
| strain, strain background (E. coli) | ELV16 λAry EDD | This paper | ELV16 attB::PtatAtatA K37E,K40D,K41D-
EAK-eyfpA206K (kanr) |
|
| strain, strain background (E. coli) | ELV16 λAry KKK | This paper | ELV16 attB::PtatAtatA D45K,D46K,E47K-EAK-eyfpA206K (kanr) | |
| strain, strain background (E. coli) | DADE λAry D31K | This paper | DADE attB::PtatAtatAD31K-EAK-eyfpA206K (kanr) | |
| strain, strain background (E. coli) | DADE λAry K49D | This paper | DADE attB::PtatAtatAK49D-EAK-eyfpA206K (kanr) | |
| strain, strain background (E. coli) | DADE λAry K52D | This paper | DADE attB::PtatAtatAK52D-EAK-eyfpA206K (kanr) | |
| strain, strain background (E. coli) | DADE λAry KKK | This paper | DADE attB::PtatAtatA D45K,D46K,E47K-EAK-eyfpA206K (kanr) | |
| strain, strain background (E. coli) | MΔABC λAry EDD | This paper | MC4100 ΔtatABC::apra attB::PtatAtatA K37E,K40D,K41D-EAK-eyfpA206K (kanr) | |
| antibody | anti-CueO | This paper | Rabbit poly clonal against CueO mature domain. Affinity purified (1:200) | |
| antibody | anti-DnaK | Abcam | Abcam ab69617; Clone 8E2/2 | Mouse monoclonal (1:20000) |
| antibody | anti-TatA | Alcock et al., 2016 | Rabbit polyclonal against TatA soluble domain (1:5000) | |
| antibody | anti-TatB | Alcock et al., 2016 | Rabbit polyclonal against TatB C-terminal peptide. Affinity purified (1:400) | |
| antibody | anti-TatC | Alcock et al., 2016 | Rabbit polyclonal against TatC C-terminal peptide. Affinity purified (1:1000) | |
| recombinant DNA reagent | pQE80-CueO | Leake et al., 2008 | Synthesis of E. coli CueO with a C-terminal his6 tag | |
| recombinant DNA reagent | pKSUniA | Koch et al., 2012 | pBluescript-based vector carrying PtatA-tatA | |
| recombinant DNA reagent | pBSTatAry | Alcock et al., 2013 | pBluescript-based vector carrying PtatA-tatA-EAK-eyfpA206K | |
| recombinant DNA reagent | pRS552 | Simons et al., 1987 | Shuttle vector for integration of DNA at the E. coli phage lambda attachment site (attB) | |
| recombinant DNA reagent | λRS45 | Simons et al., 1987 | Phage for integration of DNA at the E. coli phage lambda attachment site (attB) | |
| sequence-based reagent | TatA D31K F | Sigma-Aldrich, St. Louis, Missouri | Oligonucleotide GGCTCCATCGGTTCCAAACTTGGTGCGTCGATC | |
| sequence-based reagent | TatA D31K R | Sigma-Aldrich | Oligonucleotide GATCGACGCACCAAGTTTGGAACCGATGGAGCC | |
| sequence-based reagent | TatA K49D F | Sigma-Aldrich | Oligonucleotide CAATGAGCGATGATGAACCAGATCAGGATAAAACCAGTCAGG | |
| sequence-based reagent | TatA K49D R | Sigma-Aldrich | Oligonucleotide CCTGACTGGTTTTATCCTGATCTGGTTCATCATCGCTCATTG | |
| sequence-based reagent | TatA K52D F | Sigma-Aldrich | Oligonucleotide GAACCAAAGCAGGATGATACCAGTCAGGATGCTG | |
| sequence-based reagent | TatA K52D R | Sigma-Aldrich | Oligonucleotide CAGCATCCTGACTGGTATCATCCTGCTTTGGTTC | |
| sequence-based reagent | TatA EDD F | Sigma-Aldrich | Oligonucleotide CTTGGTGCGTCGATCGAAGGCTTTGATGATGCAATGAGCGATGATG | |
| sequence-based reagent | TatA EDD R | Sigma-Aldrich | Oligonucleotide CATCATCGCTCATTGCATCATCAAAGCCTTCGATCGACGCACCAAG | |
| sequence-based reagent | TatA KKK F | Sigma-Aldrich | Oligonucleotide GCTTTAAAAAAGCAATGAGCAAAAAGAAACCAAAGCAGGATAAAACC | |
| sequence-based reagent | TatA KKK R | Sigma-Aldrich | Oligonucleotide GGTTTTATCCTGCTTTGGTTTCTTTTTGCTCATTGCTTTTTTAAAGC | |
| sequence-based reagent | TatA zip2 F | Sigma-Aldrich | Oligonucleotide CTTGGTGCGTCGATCGAAGGCTTTGATGATGCAATGAGCAAAAAG | |
| sequence-based reagent | TatA zip2 R | Sigma-Aldrich | Oligonucleotide CTTTTTGCTCATTGCATCATCAAAGCCTTCGATCGACGCACCAAG |