Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
| Primer name | Sequence |
|---|---|
|
| |
| L-selectin forward | TGTGGAGCATCTGGAAACTG |
| L-selectin reverse | AGGAATGAAGAGGGGGTTGT |
| P-selectin forward | TGCTGTCCATTGTCCTGAAG |
| P-selectin reverse | CTTTGGTCCGAACACCACTT |
| E-selectin forward | AGCTACCCATGGAACACGAC |
| E-selectin reverse | CGTTATCCCAGATGCCAGAT |
