. 2017 Sep 7;6(3):278–286. doi: 10.1016/j.ijppaw.2017.09.001

Table 1.

Target–specific primers (F: forward direction, R: reverse direction) for the amplification of the variable regions of the helminth and Sarcocystis spp. cox1 and 18S rRNA genes.

#	target	primer name	primer sequence 5′–3′	potential target species	∼product size
1	cox1	JB3F	TTTTTTGGGCATCCTGAGGTTTAT^b	Alaria alata^d Echinococcus spp.b^,^d Mesocestoides litteratus^d Taenia spp.^d Toxascaris leonina^d Toxocara canis^d Uncinaria stenocephala^d	396 bp
1	cox1	JB4.5R	TAAAGAAAGAACATAATGAAAATG^b		396 bp
2	18S	18S_965F^a	GGCGATCAGATACCGCCCTAGTT^c	Crenosoma vulpis^d Capillaria spp.^c Trichuris vulpis^c	606 bp
2	18S	18S_1573R^a	TACAAAGGGCAGGGACGTAAT^c		606 bp
3	18S	proti15F	TGCCAGTAGTCATATGCTTGTYT^d	Sarcocystis spp.^d	378 bp
3	18S	proti440R	CAGGCYCSCTCTCCGGA^d	Sarcocystis spp.^d	378 bp
4	18S	SarAF	CTGGTTGATCCTGCCAGTAG^e	Sarcocystis spp.^e	530 bp
4	18S	SarAR	TTCCCATCATTCCAATCACT^e	Sarcocystis spp.^e	530 bp
5	18S	SarBF	GGGAGGTAGTGACAAGAAATAACAA^e	Sarcocystis spp.^e	467 bp
5	18S	SarBR	GGCAAATGCTTTCGCAGTAG^e	Sarcocystis spp.^e	467 bp

The 18S_965F/18S_1573R primer pair failed to amplify parasite DNA from faecal samples.

(Bowles et al., 1992).

(Guardone et al., 2013).

(Lesniak et al., 2017).

(Kutkienė et al., 2010).