Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
In vitro validation of sgRNA targeting efficiencies.
| Chr | Target gene | NCBI Gene ID | Target exon | Target site | PAM | #Embryos sequenced | #Embryos with indels (%) |
|---|---|---|---|---|---|---|---|
| 19 | FOXN1 | 100346912 | 3 | GCAATGCTGGGGCTGTGCGG | GGG | 8 | 7 (87.5) |
| 3 | PRKDC | 100125348 | 1 | TTGTCGTGCGGGGACCGCTG | CGG | 5 | 2 (40.0) |
| X | IL2RG | 103351862 | 1 | GGAGCCACCCGATCCACTGG | GGG | 6 | 3 (50.0) |
| 1 | RAG1 | 100328950 | 1 | GCTGGAGATTGCTCAAGGGA | GGG | 7 | 5 (71.4) |
| 1 | RAG2 | 100328951 | 1 | GTGGCTGGGTAACGGAGAGG | AGG | 7 | 7 (100) |
Chr: chromosome#.
