Forward Primer (5' to 3')	Reverse Primer  (5' to 3')	Thermocylcer conditions
IAV	TATTCGTCTCAGGGAGCAAAAGCAGGGG	ATATCGTCTCGTATTAGTAGAAACAAGGGTGTTTT	42 ºC for 60 min, 94 ºC for 2 min/5 cycles of 94 ºC for 20 s, 50 ºC for 30 s and 68 ºC for 3 min 30 s, followed by 40  cycles of 94 ºC for 20 s, 58 ºC for 30 s, and 68 ºC for 3 min 30 s with a final extension time at 68 ºC for 10 min
IBV	GGGGGGAGCAGAAGCAGAGC	CCGGGTTATTAGTAGTAACAAGAGC	45 ºC for 60 min, 55 ºC for 30 min, 94 ºC for 2 min/5 cycles of 94 ºC for 20 s, 40 ºC for 30 s and 68 ºC for 3 min 30 s, followed by 40  cycles of 94 ºC for 20 s, 58 ºC for 30 s, and 68 ºC for 3 min 30 s with a final extension time at 68 ºC for 10 min