Antibodies |
|
anti-E (5D4) |
Hybridoma from ATCC |
5D4-11 (ATCC® HB-49™), RRID: CVCL_J928; Henchal et al. (1982)
|
anti-NS3 (E1D8) |
Hybridoma generated in Harris Laboratory |
E1D8, Balsitis et al. (2009)
|
|
Bacterial and Virus Strains |
|
E. coli TOP10 competent cells |
Invitrogen |
C4040-10 |
|
Biological Samples |
|
PBMC and plasma samples |
This paper: Table S1
|
N/A |
|
Chemicals, Peptides, and Recombinant Proteins |
|
Kanamycin Sulfate |
Life Technologies |
11815-024 |
Chloramphenicol >=98% (TLC) |
Sigma-Aldrich |
C0378-25G |
|
Critical Commercial Assays |
|
RNeasy Mini kit |
Qiagen |
Cat No./ID: 74104 |
QIAamp Viral RNA Mini Kit |
Qiagen |
Cat No./ID: 52904 |
QIAquick Gel Extraction Kit |
Qiagen |
Cat No./ID: 28704 |
Nextera XT DNA Sample Preparation Kit |
Illumina |
FC-131-1096 |
SuperScript III One-Step RT-PCR System |
Invitrogen |
12574-035 |
mMessage mMachine T7 Kit |
Life Technology |
AM1344M |
MinElute Gel Extraction Kit (50) (70bp to 4kb) |
Qiagen |
Qia 28604 |
|
Deposited Data |
|
Fastq files for all these samples have been deposited into |
NCBI's Sequence Read Archive |
BioProject ID PRJNA394021 |
|
Experimental Models: Cell Lines |
|
Baby hamster kidney cells (BHK-21 clone 15) |
Gift from B. Childs (Center for Vector-born Diseases, University of California, Davis, CA) |
N/A |
C6/36 cells, 37°C in 5% CO2. |
Gift from Dr. Ralph Baric, University of North Carolina, Chapel Hill |
N/A |
U937-DC-SIGN cells |
Gift of Dr. Aravinda de Silva, University of North Carolina, Chapel Hill |
N/A |
|
Oligonucleotides |
|
Sequences of primers used for amplifying the DENV-3 genome |
Table S4 of this paper |
N/A |
DV3Ewt_r: CGACCTTAATGAGTATTGTCCCAT |
This paper |
N/A |
DV3E∗_r: CGACCTTAATGAGTATTGTCCCAa |
This paper |
N/A |
PP49_DENV3_32_F (GACTCGGAAGCTTGCTTAAC) |
This paper |
N/A |
primers (5’- GACTCGGAAGCTTGCTTAAC-3’ and 5’-TATTGACAGGCTCCTCCTTCTTAG-3’) designed to capture the prM100,101 and E315 hotspot loci |
This paper |
N/A |
Sequencing primer for prM100,101: 5’-TCAATATGCTGAAACGCGTG-3’ |
This paper |
N/A |
Sequencing primer for E315: 5’-CGGACAGGTTTGGATTTCAATG-3’ |
This paper |
N/A |
|
Recombinant DNA |
|
plasmid A-D |
Gift of Dr. Ralph Baric |
Messer et al., 2012 |
plasmid A Nicaraguan WT |
This paper |
N/A |
plasmid A Nicaraguan prM100,101
|
This paper |
N/A |
plasmid A Nicaraguan E315
|
This paper |
N/A |
|
Software and Algorithms |
|
Bowtie2 |
Langmead and Salzberg, 2012 |
http://bowtie-bio.sourceforge.net/bowtie2/index.shtml |
Samtools |
Li et al., 2009 |
http://samtools.sourceforge.net/ |
ShoRAH |
Zagordi et al., 2011 |
http://www.cbg.ethz.ch/software/shorah |