Table 1.
Summary of X-ray structural statistics
Values in parenthesis correspond to the highest-resolution shell.
| Protein | Human PRDM9c (ZF8–13) |
|---|---|
| DNA (5′-3′) | TGACCCCAGTGAGCGTTGCCC |
| DNA (3′-5′) | CTGGGGTCACTCGCAACGGGA |
| PDB code | 5V3G |
| Space group | P21 |
| Cell dimensions | |
| a, b, c (Å) | 63.1, 123.8, 70.2 |
| α, β, γ (degrees) | 90, 116, 90 |
| Beamline | APS 22-ID (SERCAT) |
| Wavelength (Å) | 1.0000 |
| Resolution (Å) | 35.2–2.41 (2.52–2.41) |
| Rmergea | 0.076 (0.721) |
| 〈I/σI〉b | 22.68 (1.3) |
| Completeness (%) | 96.5 (72.3) |
| CC½/CC | (0.541/0.838) |
| Redundancy | 6.5 (2.9) |
| Observed reflections | 233,169 |
| Unique reflections | 35,662 (2,949) |
| Refinement | |
| Resolution (Å) | 2.41 |
| No. of reflections | 35,530 |
| Rworkc/Rfreed | 0.180 / 0.225 |
| No. of atoms | |
| Protein | 2,891 |
| DNA | 1,710 |
| Zinc | 13 |
| Waters | 114 |
| B factors (Å2) | |
| Protein | 79.2 |
| DNA | 65.6 |
| Zinc | 72.4 |
| Waters | 59.9 |
| RMSD | |
| Bond lengths (Å) | 0.06 |
| Bond angles (degrees) | 1.0 |
| All-atom clash score | 8.8 |
| Ramachandran plot (%) | |
| Allowed | 98.3 |
| Additional allowed | 1.7 |
| Cβ deviation | 0 |
a Rmerge = Σ|I − 〈I〉|/ΣI, where I is the observed intensity and 〈I〉 is the averaged intensity from multiple observations.
b 〈I/σI〉 = averaged ratio of the intensity (I) to the error of the intensity (σI).
c Rwork = Σ|Fo − Fc|/Σ|Fo|, where Fo and Fc are the observed and calculated structure factors, respectively.
d Rfree was calculated using a randomly chosen subset (5%) of the reflections not used in refinement.