Table 1.
Oligonucleotides and probes used in the present work.
| Primer/Probe name | Sequence | Use in the present study |
|---|---|---|
| LX00_12105-Up-NotI-Fw | gcgcggccgcccatagaaagaagcaaga | Construction of AbH12O-A2ΔfhaC knockout strain |
| LX00_12105-Up-BglII-Rv | gcagatctgtgtttcactgttagaac | Construction of AbH12O-A2ΔfhaC knockout strain |
| LX00_12105-Down-BglII-Fw | gcagatctgattaagttcgctgatgg | Construction of AbH12O-A2ΔfhaC knockout strain |
| LX00_12105-Down-SphI-Rv | gcgcatgcggttgattgctgtgctga | Construction of AbH12O-A2ΔfhaC knockout strain |
| LX00_12105-ext-Fw | gtgtaagagttcgagtct | Confirm deletion of fhaC gene |
| LX00_12105-ext-Rv | cggtttccaattgaaaat | Confirm deletion of fhaC gene |
| LX00_12105-int-Fw | ccaaactattcgacaacag | Confirm deletion of fhaC gene |
| LX00_12105-int-Rv | gttgccatgcaagaatcac | Confirm deletion of fhaC gene |
| pMo130 site2 Fw | attcatgaccgtgctgac | Confirm construction of the AbH12O-A2ΔfhaC knockout strain |
| pMo130 site2 Rv | cttgtctgtaagcggatg | Confirm construction of the AbH12O-A2ΔfhaC knockout strain |
| LX00_12105 -SalI-Fw | gccgtcgacgtgtaatggtagcatgac | Cloning of the fhaC gene into the pWH1266-TelR plasmid for complementation |
| LX00_12105 -SalI-Rv | gccgtcgacttaataggtccaattcacg | Cloning of the fhaC gene into the pWH1266-TelR plasmid for complementation |
| TelR-Pprom-HindIII-Fw | gcgaagcttgactccagaggtcaaata | Cloning the tellurite resistance gene (TelR) into pWH1266 plasmid |
| TelR-Pprom-HindIII-Rv | gcaagctttcagaacttggcagtgagt | Cloning the tellurite resistance gene (TelR) into pWH1266 plasmid |
| RT#73-LX00_12105-Fw | caaaacggttatgtaacaacacga | qRT-PCR |
| RT#73-LX00_12105-Rv | caccgtaccggatgcaata | qRT-PCR |
| RT#3-LX00_12100-Fw | ctgggcttctgctgaacaa | qRT-PCR |
| RT#3-LX00_12100-Fw | aataaatccacccctttggtaac | qRT-PCR |
| RT#76 gyrB-Fw | tctctagtcaggaagtgggtacatt | qRT-PCR |
| RT#76 gyrB-Rv | ggttatattcttcacggccaat | qRT-PCR |