LX00_12105-Up-NotI-Fw |
gcgcggccgcccatagaaagaagcaaga |
Construction of AbH12O-A2ΔfhaC knockout strain |
LX00_12105-Up-BglII-Rv |
gcagatctgtgtttcactgttagaac |
Construction of AbH12O-A2ΔfhaC knockout strain |
LX00_12105-Down-BglII-Fw |
gcagatctgattaagttcgctgatgg |
Construction of AbH12O-A2ΔfhaC knockout strain |
LX00_12105-Down-SphI-Rv |
gcgcatgcggttgattgctgtgctga |
Construction of AbH12O-A2ΔfhaC knockout strain |
LX00_12105-ext-Fw |
gtgtaagagttcgagtct |
Confirm deletion of fhaC gene |
LX00_12105-ext-Rv |
cggtttccaattgaaaat |
Confirm deletion of fhaC gene |
LX00_12105-int-Fw |
ccaaactattcgacaacag |
Confirm deletion of fhaC gene |
LX00_12105-int-Rv |
gttgccatgcaagaatcac |
Confirm deletion of fhaC gene |
pMo130 site2 Fw |
attcatgaccgtgctgac |
Confirm construction of the AbH12O-A2ΔfhaC knockout strain |
pMo130 site2 Rv |
cttgtctgtaagcggatg |
Confirm construction of the AbH12O-A2ΔfhaC knockout strain |
LX00_12105 -SalI-Fw |
gccgtcgacgtgtaatggtagcatgac |
Cloning of the fhaC gene into the pWH1266-TelR plasmid for complementation |
LX00_12105 -SalI-Rv |
gccgtcgacttaataggtccaattcacg |
Cloning of the fhaC gene into the pWH1266-TelR plasmid for complementation |
TelR-Pprom-HindIII-Fw |
gcgaagcttgactccagaggtcaaata |
Cloning the tellurite resistance gene (TelR) into pWH1266 plasmid |
TelR-Pprom-HindIII-Rv |
gcaagctttcagaacttggcagtgagt |
Cloning the tellurite resistance gene (TelR) into pWH1266 plasmid |
RT#73-LX00_12105-Fw |
caaaacggttatgtaacaacacga |
qRT-PCR |
RT#73-LX00_12105-Rv |
caccgtaccggatgcaata |
qRT-PCR |
RT#3-LX00_12100-Fw |
ctgggcttctgctgaacaa |
qRT-PCR |
RT#3-LX00_12100-Fw |
aataaatccacccctttggtaac |
qRT-PCR |
RT#76 gyrB-Fw |
tctctagtcaggaagtgggtacatt |
qRT-PCR |
RT#76 gyrB-Rv |
ggttatattcttcacggccaat |
qRT-PCR |