Reagent type (species) or resource	Designation	Source or reference	Identifiers	Additional information
strain, strain background (Mus musculus)	mouse CD1	Other	Other	University of Manchester Mouse Facility
strain, strain background (Danio rerio)	zebrafish	Other	Other	University of Massachusetts Medical Center zebrafish Facility
antibody	anti-PECAM-1 (rat monoclonal)	BD Pharmigen	BD Pharmigen:550274	(1:100)
antibody	anti-actin, α-SMA, Cy3 conjugated (mouse monoclonal)	Sigma-Aldrich	Sigma-Aldrich: C6198	(1:400)
antibody	anti-rat IgG Alexa 488-conjugated (goat polyclonal)	Molecular probes	Molecular probes: A-11006	(1:100)
antibody	anti-Gata6 (rabbit monoclonal)	Cell signalling	Cel signalling: 5851	IF: (1:1000); ChIP: (5 μg)
antibody	anti-Meis1/2 (goat polyclonal)	Santa Cruz Biotechnology	Santa Cruz: sc-10599X	ChIP: (5 μg)
antibody	anti-H3K27ac (rabbit polyclonal)	Abcam	Abcam: ab4729	ChIP: (5 μg)
recombinant DNA reagent	Minitol2-GwB-zgata2-GFP-48			Provided by JL Skarmeta
recombinant DNA reagent	Myocd-CRE2	This paper	Other
recombinant DNA reagent	Myocd-CRE1	This paper	Other
recombinant DNA reagent	Jag1-CRE1	This paper	Other
recombinant DNA reagent	Myocd-CRE2mut	This paper	Other
recombinant DNA reagent	Myocd-CRE1mut	This paper	Other
recombinant DNA reagent	Jag1-CRE1mut	This paper	Other
recombinant DNA reagent	Gata6 cDNA	Origene	MC219384
recombinant DNA reagent	a2::Gata6	This paper	Other
recombinant DNA reagent	Meis ISH probe	Other	Other	Provided by D. Schulte
sequence-based reagent	Actb	Primerbank	6671509a1
sequence-based reagent	Gata6	Primerbank	33859556a1
sequence-based reagent	Acta2	Primerbank	6671507a1
sequence-based reagent	Tagln	Primerbank	6755714a1
sequence-based reagent	Cnn1	Primerbank	1069993a1
sequence-based reagent	Jag1	Primerbank	7305197a1
sequence-based reagent	Myocd	Primerbank	21553083a1
sequence-based reagent	Jag1-CRE1 forward	This paper	Other	AAATCACTGTCATAATTGTCCCAAA
sequence-based reagent	Jag1-CRE1 reverse	This paper	Other	TCAGGGCTTCCCACTGCTA
sequence-based reagent	Myocd-CRE1 forward	This paper	Other	TGCATGCTGCCCCCATCAAT
sequence-based reagent	Myocd-CRE1 reverse	This paper	Other	GAGGCGCAACCCAATGT GC
sequence-based reagent	Myocd-CRE2 forward	This paper	Other	TCTGGACAGCTGACACCCTTG
sequence-based reagent	Myocd-CRE2 reverse	This paper	Other	TGAGCAATAAGGGACAGGAGC
commercial assay or kit	Gateway BP Clonase II Enzyme mix	Thermo Fisher Scientific	11791020
commercial assay or kit	pCR8/GW/TOPO TA Cloning Kit with One Shot TOP10 E. coli	Thermo Fisher Scientific	450642
commercial assay or kit	TruSeq ChIP Sample Preparation kit	Illumina
commercial assay or kit	TruSeq Stranded mRNA Sample Preparation Kits	Illumina
commercial assay or kit	QIAquick Gel Extraction Kit	Qiagen	28704
commercial assay or kit	RNeasy Plus Micro Kit	Qiagen	74034
chemical compound, drug	Methyl Salicylate	Sigma-Aldrich	M2047
chemical compound, drug	Trizol	Thermo Fisher Scientific	15596–018
software, algorithm	Amira software	FEI	Version 6.4.
software, algorithm	MACS	Zhang et al., 2008	MACS2.0.10.20131216	https://pypi.python.org/pypi/MACS2/2.0.10.20131216
software, algorithm	Trimmomatic	Bolger et al., 2014	v0.32	http://www.usadellab.org/cms/?page=trimmomatic
software, algorithm	Bowtie	Langmead and Salzberg, 2012	Bowtie(v1.1.1)/Bowtie(v2.2.3)	https://sourceforge.net/projects/bowtie-bio/files/bowtie2
software, algorithm	GREAT	McLean et al., 2010	Other	http://bejerano.stanford.edu/great/public/html/
software, algorithm	TopHat	Kim et al., 2013a	TopHat (v2.1.0)	https://github.com/infphilo/tophat
software, algorithm	Cufflinks	Trapnell et al., 2010	Cufflinks(v2.2.2)	https://github.com/cole-trapnell-lab/cufflinks
software, algorithm	edgeR	Robinson et al., 2010	edgeR (v3.12.1)	https://bioconductor.org/packages/release/bioc/html/edgeR.html
software, algorithm	Homer	Heinz et al., 2010	Other	http://homer.salk.edu/homer/
software, algorithm	DiffReps	Shen et al., 2013	Other	https://code.google.com/p/diffreps/under