REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
Rabbit polyclonal anti-Pericentrin	Covance	Cat# PRB-432C; RRID: AB_2313709
Rabbit polyclonal anti-Pericentrin	Abcam	Cat#ab4448; RRID: AB_304461
Mouse monoclonal anti-Pericentrin	BD Biosciences	Cat#611814; RRID: AB_ 399294
Rabbit anti-Pericentrin	Kunsoo Rhee [52]	N/A
Mouse monoclonal anti-myosin, sarcomere (MHC)	Developmental Studies Hybridoma Bank (DSHB)	Cat#MF20; RRID: AB_ 2147781
Mouse monoclonal anti-GAPDH [GT239]	GeneTex	Cat#GTX627408; RRID: AB_11174761
Mouse monoclonal anti-Nesprin-1, clone 9F10	This paper	N/A
Mouse monoclonal anti-Nesprin-1, clone MANNES1A	Glenn E. Morris [18]	N/A
Mouse monoclonal anti-Nesprin-1, clone MANNES1E	Glenn E. Morris [18]	N/A
Mouse monoclonal anti-Myc, 9E10	Developmental Studies Hybridoma Bank (DSHB)	Cat#9E10; RRID: AB_ 2266850
Rabbit polyclonal anti-Akap9	Sigma-Aldrich	Cat#HPA026109; RRID: AB_844688
Rabbit polyclonal anti-PCM1	Bethyl Laboratories	Cat#A301-149A; RRID: AB_ 2160197
Mouse monoclonal anti-Myogenin, F5D	Developmental Studies Hybridoma Bank (DSHB)	Cat#F5D; RRID: AB_2146602
Rabbit polyclonal anti-Sun1 (UNC84A)	Sigma-Aldrich	Cat#AV49929; RRID: AB_1858623
Rabbit anti Sun1	[53]	N/A
Rabbit anti-Sun2	ImmuQuest	Cat# IQ444; RRID: AB_10659143
Rabbit monoclonal anti-Kif5b [EPR10276(B)]	Abcam	Cat#ab167429
anti-Klc1/2	Scott T. Brady	N/A
Mouse monoclonal anti-Cep170	Thermo Fisher Scientific	Cat#41-3200; RRID: AB_ 2533502
Mouse monoclonal anti-GM130	BD Biosciences	Cat##610823; RRID: AB_398142
Rabbit polyclonal anti-CDK5RAP2	Bethyl Laboratories	Cat#IHC-00063; RRID: AB_2076863
Donkey anti-Rabbit IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 488	Thermo Fisher Scientific	Cat#A21206
Donkey anti-Rabbit IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 568	Thermo Fisher Scientific	Cat#A10042
Goat anti-Mouse IgG1 Cross-Adsorbed Secondary Antibody, Alexa Fluor 488	Thermo Fisher Scientific	Cat#A21121
Goat anti-Mouse IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 555	Thermo Fisher Scientific	Cat#21424
Goat anti-Mouse IgG1 Cross-Adsorbed Secondary Antibody, Alexa Fluor 568	Thermo Fisher Scientific	Cat#A21124
Goat anti-Mouse IgG1 Cross-Adsorbed Secondary Antibody, Alexa Fluor 647	Thermo Fisher Scientific	Cat#A21240
Goat anti-Mouse IgG2b Cross-Adsorbed Secondary Antibody, Alexa Fluor 568	Thermo Fisher Scientific	Cat#A21144
Goat anti-Rabbit IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 647	Thermo Fisher Scientific	Cat#21245
Goat anti-Mouse IgG2b Cross-Adsorbed Secondary Antibody, Alexa Fluor 647	Thermo Fisher Scientific	Cat#A21242
Donkey anti-Rat IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 488	Thermo Fisher Scientific	Cat#A21208
Goat anti-Mouse IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor Plus 647 (for SD-dSTORM)	Thermo Fisher Scientific	Cat#A32728
Goat anti-Rabbit IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor Plus 647 (for SD-dSTORM)	Thermo Fisher Scientific	Cat#A32733
Donkey anti-Mouse IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, CF680 (for SD-dSTORM)	Biotium	Cat#20483
Donkey anti-Rabbit IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, CF680 (for SD-dSTORM)	Biotium	Cat#20344
Bacterial and Virus Strains
Escherichia coli: BL21(DE3) strain	Stratagene / Agilent	Cat#200131
Chemicals, Peptides, and Recombinant Proteins
Nocodazole	Sigma-Aldrich	Cat#M1404
Lipofectamine 2000 transfection reagent	Thermo Fisher Scientific	Cat#11668019
Lipofectamine 3000 transfection reagent	Thermo Fisher Scientific	Cat#L3000008
jetPRIME	Polyplus-transfection	Cat#114-07
Biotin	Sigma-Aldrich	Cat#B4639
Doxycycline	Fisher Bioreagents	Cat#BP2653-1
Puromycin	Sigma-Aldrich	Cat#P8833
Lys-C protease	Wako	Cat# 129-02541
Trypsin	Promega	Cat#V5111
Dynabeads MyOne Streptavidin C1	Thermo Fisher Scientific	Cat#65001
Collagenase type II	GIBCO	Cat#17101-015
Dispase	GIBCO	Cat#17105-041
gelatin	Sigma-Aldrich	Cat#G1890
Matrigel	Corning Life Sciences	Cat#354230
Dulbecco’s modified Eagle’s medium (DMEM)	GIBCO	Cat#41966
DMEM with GlutaMAX	GIBCO	Cat#61965-026
DMEM 199 medium	GIBCO	Cat#41150
Iscove’s Modified Dulbecco’s Medium (IMDM) with GlutaMAX	GIBCO	Cat#31980
Hanks’ Balanced Salt Solution	GIBCO	Cat#14170-112
Ham’s F10	GIBCO	Cat#11550043
Advanced RPMI 1640	GIBCO	Cat#12633020
Opti-MEM I Reduced Serum Medium	GIBCO	Cat#31985070
Fetal calf serum (FCS)	Eurobio	Cat#CVFSVF0001
Fetal bovine serum (FBS)	GIBCO	Cat#10270
Penicillin/streptomycin	GIBCO	Cat#15140-122
Horse serum	GIBCO	Cat#26050088
HAT supplement	GIBCO	Cat#21060017
Goat serum	Sigma-Aldrich	Cat#G9023
Bovine fetuin	Life Technologies	Cat#10344026
recombinant human EGF	Life Technologies	Cat#PHG0311
recombinant human FGF-basic	Life Technologies	Cat#PHG0026
bFGF	Invitrogen	Cat#13256029
recombinant human insulin	Sigma-Aldrich	Cat#91077C
dexamethasone	Sigma-Aldrich	Cat#D4902
gentamicin	GIBCO	Cat#15750
Complete protease inhibitor	Roche	Cat#11697498001
β-mercaptoethylamine (MEA)	Sigma-Aldrich	Cat#30070
glucose oxidase	Sigma-Aldrich	Cat#G2133
catalase	Sigma-Aldrich	Cat#C100
Lysozyme	Sigma-Aldrich	Cat#L7651
Glutathione Sepharose 4B	GE Healthcare	Cat#17075601
GST-Nesprin-1α-326-634	This paper	N/A
Polyethylene glycol solution, 50% w/v, Mw ∼1500	Sigma-Aldrich	Cat#P7181
Freund’s Complete Adjuvant	Thermo Fisher Scientific	Cat#77140
Freund’s Incomplete Adjuvant	Thermo Fisher Scientific	Cat#77145
Fluoromount-G	Southern Biotech	Cat#0100-01
Prolong Diamond	Invitrogen	Cat#P36961
1,4-Diazabicyclo[2.2.2]octane (DABCO)	Sigma-Aldrich	Cat#D27802
Vectashield	Vector Laboratories	Cat#H-1000
4’,6-diamidino-2-phenylindole dihydrochloride (DAPI)	Molecular Probes	Cat#D1306
4x Laemmli sample buffer	Bio-Rad	Cat#1610747
1x Tris/Glycine buffer	Bio-Rad	Cat#1610771
IRDye 800CW Streptavidin	Li-Cor	Cat#925-32230
IRDye 680RD Goat anti-Mouse IgG (H + L)	Li-Cor	Cat#926-68070
Critical Commercial Assays
ThermoScriptTM RT-PCR System for First-Strand cDNA Synthesis	Thermo Fisher Scientific	Cat#11146025
Pierce BCA Protein Assay Kit	Thermo Fisher Scientific	Cat#23225
TMT10plex Isobaric Label Reagent Set	Thermo Fisher Scientific	Cat# 90406
SuperSignal West Pico Chemiluminescence kit	Thermo Fisher Scientific	Cat#34080
Luminata Forte Western HRP Substrate	Millipore	Cat#WBLUF0100
Experimental Models: Cell Lines
Mouse: C2C12 cell line	American Type Culture Collection (ATCC)	Cat# CRL-1772; RRID: CVCL_0188
Human: immortalized healthy control myoblasts	[15, 16]	N/A
Human: immortalized myoblasts from a congenital muscular dystrophy patient carrying a homozygous nonsense mutation within the SYNE1 (23560 G>T) gene	[15, 16]	N/A
Rat hybridoma cell line YL1/2, anti-tubulin reactivity	European Collection of Authenticated Cell Cultures (ECACC)	Cat#92092402; RRID: CVCL_J781
Human: HeLa cell line	American Type Culture Collection (ATCC)	Cat#: CCL-2 RRID: CVCL_0030
Rat: NRK cell line	American Type Culture Collection (ATCC)	Cat#: CRL-6509 RRID: CVCL_3758
Mouse: SP2/0-Ag14 myeloma cell line	Gift of Karl Riabowol [52]	RRID: CVCL_2199
Experimental Models: Organisms/Strains
Mouse: Sun1−/−: B6;129-Sun1tm1.1Ktj/N	[54]	RRID: MGI:3838371
Mouse: Sun2−/−: B6;129S6-Sun2tm1Mhan/J	[28]	JAX: 012716 RRID: MGI:3850091
Oligonucleotides
siRNA targeting sequence: mouse Nesprin-1 #1 CCAUCGAGUCUCACAUCAAtt	GeneCust	N/A
siRNA targeting sequence: mouse Nesprin-1 #2 AGUAAGAGGAGAAGGAAUAtt	GeneCust [8]	N/A
siRNA targeting sequence: mouse Sun1 #1 GGCUAUUGAUUCGCACAUUtt	Ambion	Cat#4390771 s94911
siRNA targeting sequence: mouse Sun2 #1 CUCUCAGGAUGAUAACGAUtt	Ambion	Cat#4390771 s104591
siRNA targeting sequence: mouse Pericentrin #1 GCCGAUCAACAAUUGCUAAtt	Ambion	Cat#4390771 s71317
siRNA targeting sequence: mouse Pericentrin #2 GGGUUUAAUGAAUUGGUCAtt	Ambion	Cat#4390771 s71316
siRNA targeting sequence: mouse Akap450 #1 AUCACUGUGCAACUUGAAUAAAGAA	Integrated DNA Technologies	Cat# mm.Ri.Akap9.13.1
siRNA targeting sequence: mouse Akap450 #2 UACCUUUCAUUGGACAGGUUUCUAUCG	Integrated DNA Technologies	Cat# mm.Ri.Akap9.13.2
siRNA targeting sequence: mouse Pcm1 #1 AGUCAGAUUCUGCAACAUGAUCUTG	Integrated DNA Technologies	Cat# mm.Ri.Pcm1.13.1
siRNA targeting sequence: mouse Pcm1 #2 AAUAGUAUCCCGUAAAGCUUCAAACAU	Integrated DNA Technologies	Cat# mm.Ri.Pcm1.13.2
See also Table S2 for other siRNAs and primers	N/A	N/A
Recombinant DNA
pcDNA3.1 EGFP-Nesprin-1α	This paper	N/A
pTripZ-mycBirA∗-Nesprin-1α	This paper	N/A
pGEX-4T-1 GST-Nesprin-1α-326-634	This paper	N/A
pTripZ-mycBirA∗-Nesprin-2β	This paper	N/A
pTripZ-mycBirA∗-Nesprin-1α (WD/AA)	This paper	N/A
pX330-U6-Chimeric BB-CBh-hSpCas9	[55]	Addgene plasmid Cat#42230
pX330-Nesprin-1-N-ter-CRISPR	This paper	N/A
pX330-Nesprin-1-C-ter-CRISPR	This paper	N/A
dsRed-PACT	Sean Munro [34]	N/A
Software and Algorithms
Cytosim	Francois Nedelec [50]	N/A
GraphPad Prism	GrahPad Software	Version 6; RRID: SCR_002798
Fiji	https://fiji.sc	RRID: SCR_002285
SoftWorX program	Applied Precision	N/A
Metamorph Software	Molecular Devices	RRID: SCR_002368
Proteome Discoverer 2.1	Thermo Fisher Scientific	RRID: SCR_014477
Mascot 2.5.1	Matrix Science	RRID: SCR_014322
Spreading factor algorithm	This paper, VBA Excel	N/A
Other
Inverted Nikon Ti microscope	Nikon	N/A
DeltaVision CORE	GE / Applied Precision	N/A
Plan Apochromat 40 × /1.35 NA oil-immersion objective lens	Olympus	N/A
CCD camera CoolSNAP HQ	Photometrics	N/A
Leica SPE confocal microscope	Leica	N/A
Nikon Spinning disk confocal microscope	Nikon	N/A
OMX V4 Blaze	GE Healthcare	Cat#29065721
CoolSNAP HQ2 camera	Roper Scientific	N/A
Zeiss LSM510 confocal microscope	Carl Zeiss AG	N/A
Environmental chamber	Okolab	Stage Top Incubator, H301
Odyssey Imaging System	Li-Cor	No longer available
Orbitrap Fusion mass spectrometer coupled to nanoUPLC Easy LC 1000 system	Thermo Fisher Scientific	N/A
Sep-Pak C-18 cartridges	Waters	Cat# WAT051910
C18 Basic Resins 10 μm	Dr. Maisch	Cat# r10.b9.0025
Easy spray column 50 cm x 75 μm (C18, 1.8 μm)	Thermo Fisher Scientific	Cat#ES-803
8-well μ-slides	ibidi	Cat#80826
96-well μ-plates	ibidi	Cat#89626
Slides with molds providing a 100 μl spherical void	Carl Roth	Cat#H884.1
TetraSpeck multicolor beads	Invitrogen	Cat#T7279
QIAshredder	Quiagen	Cat#79656
4-15% Mini-PROTEAN TGX protein gels	Bio-Rad	Cat#4561084
Trans-Blot Turbo Transfer system	Bio-Rad	Cat# 1704150
4-12% NuPAGE NovexBis-Tris gels	Invitrogen	Cat#NP0335
Amersham Hyperfilm	GE Healthcare	Cat#10094984