Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Real‐time PCR primer sequence
| Target molecule | Forward | Reverse |
|---|---|---|
| DRD1 | cttcgatgtgtttgtgtggttt | tcttccttcttcaggtcctcag |
| DRD2 | cactcagatgcttgccattgttc | gtgggatgttgcaatcacagtgta |
| DRD3 | tcaccctggatgtcatgatgtgta | gtgatcatgagtgccacacgtcta |
| DRD4 | accccatcatctacaccatctt | agacatcagcggttctttcag |
| DRD5 | gctacgagcgcaagatgac | attgagttggaccgggatgaag |
| DAT | gtactggcggctatgctggaa | gggtctgaaggtcacaatgctg |
| β‐actin | cacgatggaggggccggactcatc | taaagacctctatgccaacacagt |
