Skip to main content
. Author manuscript; available in PMC: 2017 Oct 24.
Published in final edited form as: Bio Protoc. 2016 Jun 20;6(12):e1846. doi: 10.21769/BioProtoc.1846

Figure 1. μChIP of the histone mark H3K9Acetyl with increasing amount of antibody in mouse cortical astrocytes.

Figure 1

Real-time PCR was performed in the promoter region of Pax6 (F: cggtgaaagaagccactagg, R: agggaacacaccaactttcg) and in the promoter region of T-cell receptor (TCR) (F: cttacaccccaaacctccaa, R: gggaggatgaggagaaaagg).