Skip to main content
. Author manuscript; available in PMC: 2017 Oct 24.
Published in final edited form as: Bio Protoc. 2016 Jun 20;6(12):e1846. doi: 10.21769/BioProtoc.1846

Figure 2. μChIP of overexpressed HA-tagged Neurogenin2 in NS-5 cells with increasing amount of antibody.

Figure 2

Real-time PCR was performed with primers recognizing the promoter region of the Neurogenin2 (Neurog2) target gene Fbxw7 (F: gcgctttgaagaaagacctg, R: gttttcaaggggcgaatgta) and the ORF region of Dll1, not bound by Neurog2 (F: gtctcaggaccttcacagtag, R: gagcaaccttctccgtagtag).