Key resource table.
| Reagent type (species) or resource |
Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Homo sapiens) | CD95L | NA | NM_000639 | |
| Gene (H. sapiens) | CD95 | NA | NM_000043 | |
| Cell line (H. sapiens) | NB7 | PMID: 10802708 | BRENDA Tissue and Enzyme Source Ontology: BTO_0003439; RRID:CVCL_8824 |
Human neuroblastoma derived from autonomic ganglia; carries a deletion in both alleles of CASP8 |
| Cell line (H. sapiens) | HeyA8 | PMID: 4016745; PMID: 25984343 |
RRID: CVCL_8878; RRID:CVCL_8878 |
Human high grade ovarian serous adenocarcinoma; derived from parent Hey cells (RRID: CVCL_0297) |
| Cell line (H. sapiens) | HeyA8 ΔshL3 | this paper | NA | Pool of three HeyA8 cell clones with homozygous 41 nucleotide deletion of the shL3 target site (chr1:172,665,726–172,655,766; Human Dec. 2013 GRCh38/hg38 assembly) produced using CRISPR/Cas9 technology. |
| Cell line (H. sapiens) | HeyA8 ΔsiL3 | this paper | NA | Pool of three HeyA8 cell clones with homozygous 64 nucleotide deletion of the siL3 target site (chr1:172,669,178–172,659,241; Human Dec. 2013 GRCh38/hg38 assembly) produced using CRISPR/Cas9 technology. |
| Cell line (H. sapiens) | HeyA8 ΔshR6; shR6 k.o. clone #11 |
this paper | NA | HeyA8 cell clone #11 with homozygous 227 nucleotide deletion of the shR6 target site (chr10:89,008,920–89,009,146; Human Dec. 2013 GRCh38/hg38 assembly) produced using CRISPR/Cas9 technology; verified homozygous CD95 protein knockout |
| Cell line (H. sapiens) | HeyA8 shR6 k.o. clone #1 |
this paper | NA | HeyA8 cell clone #1 with a small deletion and the 227 nucleotide deletion of the shR6 target site and an insertion of the pMJ920 plasmid fragment in CD95 produced using CRISPR/Cas9 technology; verified homozygous CD95 protein knockout |
| Cell line (H. sapiens) | HeyA8 shR6 k.o. clone #2 |
this paper | NA | HeyA8 cell clone #2 with a 227 nucleotide deletion of the shR6 target site (chr10:89,008,920–89,009,146; Human Dec. 2013 GRCh38/hg38 assembly) in one allele and an insertion of the pSCB plasmid fragment in the other in CD95 produced using CRISPR/Cas9 technology; verified homozygous CD695 protein knockout |
| Cell line (H. sapiens) | MCF-7 | ATCC | ATCC: HTB-22; RRID:CVCL_0031 |
Human adenocarcinoma of the mammary gland, breast; derived from metastatic site: pleural effusion |
| Cell line (H. sapiens) | HCT116 | Korean Collection for Type Cultures (KCTC) |
KCTC: cat#HC19023; ATCC: CCL_247; RRID:CVCL_0291 |
Human colorectal carcinoma |
| Cell line (H. sapiens) | Drosha-/-; Drosha-/-
clone #40 |
Korean Collection for Type Cultures (KCTC); PMID: 26976605 |
KCTC: cat#HC19020 | HCT116 clone #40 with homozygous protein knockout of Drosha; knockout achieved using CRISPR/Cas9 which resulted in a single nucleotide insertion in one allele and a 26 nuceotide deletion in the other |
| Cell line (H. sapiens) | Dicer-/-; Dicer-/-
clone #43 |
Korean Collection for Type Cultures (KCTC); PMID: 26976606 |
KCTC: cat#HC19023 | HCT116 clone #43 with homozygous protein knockout of Dicer; knockout achieved using CRISPR/Cas9 which resulted in a three nucleotide insertion and 14 nucleotide deltion in one allele and a 35 nuceotide deletion in the other |
| Cell line (H. sapiens) | Dicer-/-; Dicer-/-
clone #45 |
Korean Collection for Type Cultures (KCTC); PMID: 26976607 |
KCTC: cat#HC19024 | HCT116 clone #45 with homozygous protein knockout of Dicer; knockout achieved using CRISPR/Cas9 which resulted in a 53 nucleotide deltion in one allele and a 28 nuceotide deletion in the other |
| Cell line (H. sapiens) | 293T | ATCC | ATCC: CRL-3216; RRID:CVCL_0063 |
Derived from HEK293 cells (ATCC: CRL-1573); express large T antigen; used for packaging viruses |
| Cell line (H. sapiens) | 293T ΔshL3 | this paper | NA | Pool of three 293T cell clones with homozygous 41 nucleotide deletion of the shL3 target site (chr1:172,665,726–172,655,766; Human Dec. 2013 GRCh38/hg38 assembly) produced using CRISPR/Cas9 technology. |
| Cell line (H. sapiens) | Phoenix-AMPHO | ATCC | ATCC: CRL-3213; RRID:CVCL_H716 |
Second generation retrovirus producer cell line |
| Antibody | anti-β-actin antibody (mouse monoclonal) |
Santa Cruz | Santa Cruz: cat#sc-47778; RRID:AB_626632 |
1:2000; for western blot; primary Ab |
| Antibody | anti-human CD95L (Mouse IgG1 monoclonal) |
BD Biosciences | BD Biosciences: cat#556387; RRID:AB_396402 |
1:500; for western blot; primary Ab |
| Antibody | anti-human CD95 (rabbit polyclonal) |
Santa Cruz | Santa Cruz: cat#sc-715; RRID:AB_2100386 |
1:1000; for western blot; primary Ab |
| Antibody | anti-human AGO2 (rabbit monoclonal) |
Abcam | Abcam: cat#AB186733; RRID:AB_2713978 |
1:2000; for western blot; primary Ab |
| Antibody | anti-human Drosha (rabbit monoclonal) |
Cell Signaling | Cell Signaling: cat#3364; RRID:AB_2238644 |
1:1000; for western blot; primary Ab |
| Antibody | anti-human Dicer (rabbit polyclonal) |
Cell Signaling | Cell Signaling: cat#3363; RRID:AB_2093073 |
1:1000; for western blot; primary Ab |
| Antibody | Goat anti-rabbit, IgG-HRP |
Southern Biotech | Southern Biotech: cat#SB-4030–05; RRID:AB_2687483 |
1:5000; for western blot; secondary Ab |
| Antibody | Goat anti-rabbit, IgG-HRP |
Cell Signaling | Cell Signaling: cat#7074; RRID:AB_2099233 |
1:2000; for western blot; secondary Ab |
| Antibody | Goat anti-mouse; IgG1-HRP |
Southern Biotech | Southern BioTech: cat#1070–05; RRID:AB_2650509 |
1:5000; for western blot; secondary Ab |
| Isotype control | FITC-mouse IgG1, κ isotype control |
BD Biosciences | BD Biosciences: cat#551954; RRID:AB_394297 |
4 uL used for 1 × 10^6 cells; for flow cytometry |
| Antibody | FITC-mouse anti-Human CD95 |
BD Biosciences | BD Biosciences: cat#556640; RRID:AB_396506 |
4 uL used for 1 × 10^6 cells; for flow cytometry |
| Recombinant protein reagent |
sCD95L (S2) | PMID: 14504390 | NA | Soluble form of human CD95L (amino acids 137–281); recombinant protein |
| Recombinant protein reagent |
LzCD95L | PMID: 14504390 | NA | Leucine zipper tagged CD95L; recombinant protein |
| Chemical compound | propidium iodide | Sigma-Aldrich | Sigma-Aldrich: cat#P4864 |
Used for subG1 flow cytometry analysis |
| Chemical compound | puromycin | Sigma-Aldrich | Sigma-Aldrich: cat#P9620 |
Used for selection of cells expressing puromycin resistance cassettes |
| Chemical compound | G418 | Affymetrix | Affymetrix: cat#11379 |
Used for selection of cells expressing G418 resistance cassette |
| Recombinant DNA reagent |
venus-CD95L sensor (plasmid) |
this paper | NA | Modified CD510B-1 lentiviral vector (PMID: 25366259) was used as backbone; vector expresses a venus-human CD95L conjugate mRNA that can be used to monitor RNAi activity of si/shRNAs targeting CD95L using venus fluorescence. |
| Recombinant DNA reagent |
venus-CD95 sensor (plasmid) |
this paper | NA | Modified CD510B-1 lentiviral vector (PMID: 25366259) was used as backbone; vector expresses a venus-human CD95 conjugate mRNA that can be used to monitor RNAi activity of si/shRNAs targeting CD95 using venus fluorescence. |
| Recombinant DNA reagent |
pLenti-GIII-CMV- RFP-2A-Puro vector; pLenti |
ABM Inc | NA | pLenti control empty lentiviral vector; carries an RFP-2a-puromycin resistance cassette |
| Recombinant DNA reagent |
pLNCX2 | Clontech | Clontech: cat#631503 |
pLNCX2 control empty retroviral vector; carries a neomycin resistance cassette |
| Recombinant DNA reagent |
pTIP | PMID: 24656822 | NA | Lentivirus used for doxycycline- induced expression of shRNAs; contains puromycin resistance cassette; modified from the original backbone which contained a GFP cassette instead of a puromycin cassette (PMID: 17311008); original backbone from the Rossi lab. |
| Recombinant DNA reagent |
pLenti-CD95L-WT | this paper | NA | pLenti-GIII-CMV-RFP-2A-Puro vector that expresses human wild type CD95L cDNA (NM_000639.2); used to express wt human CD95L upon infection with lentiviral particles |
| Recombinant DNA reagent |
pLenti-CD95L- L1MUT |
this paper | NA | pLenti-GIII-CMV-RFP-2A-Puro vector that expresses human CD95L cDNA (NM_000639.2) with 8 silentmutations overlapping the shL1 target site (GCATCATCTTTGGAGAAGCAA - > GCCTCGTCCCTAGAAAAACAG); used to express shL1-resistant human CD95L upon infection with lentiviral particles |
| Recombinant DNA reagent |
pLenti-CD95L- L3MUT |
this paper | NA | pLenti-GIII-CMV-RFP-2A-Puro vector that expresses human CD95L cDNA (NM_000639.2) with 8 silent mutations overlapping the shL3 target site (ACTGGGCTGTACTTTGTATAT - > ACCGGATTATATTTCGTGTAC); used to express shL3-resistant human CD95L upon infection with lentiviral particles |
| Recombinant DNA reagent |
pLNCX2-CD95-WT | this paper | NA | pLNCX2 vector that expresses human CD95 cDNA (BC012479.1); used to express wild type CD95 upon infection with lentiviral particles |
| Recombinant DNA reagent |
pLNCX2-CD95-R6MUT | this paper | NA | pLNCX2 vector that expresses mutant human CD95 cDNA (BC012479.1) which contains 8 silent mutations overlapping the shR6 site (GTGTCGCTGTAAACCAAACTT - > ATGTCGCTGCAAGCCCAATTT); used to express shR6-resistant CD95 upon infection with lentiviral particles |
| Transfected construct | gRNA scaffold | PMID: 23287722 | IDT: synthesized as gene block |
455 nucleotide CRISPR/Cas9 gRNA scaffold synthesized as a gene block; contains promoter, gRNA scaffold, target sequence, and termination sequence; scaffold transcribes gRNAs that target Cas9 endonuclease to cut at target sites; target sequences consist of 19 nucleotides that are complementary to the target site of choice; co-transfected with Cas9 to catalyze cleavage. |
| Transfected construct | pMJ920 Cas9 plasmid | Addgene; PMID: 23386978 |
Addgene: cat#42234 | Plasmid that expresses a human codon-optimized Cas9 tagged with GFP and HA; used to express Cas9 for CRISPR-mediated deletions. |
| Chemical compound | Lipofectamine 2000 | ThermoFisher Scientific | ThermoFisher Scientific: cat#11668019 |
Transfection reagent |
| Chemical compound | Lipofectamine RNAiMAX | ThermoFisher Scientific | ThermoFisher Scientific: cat#13778150 |
Transfection reagent; used for transfection of small RNAs such as siRNAs |
| Commercial assay or kit | StrataClone Blunt PCR Cloning Kit |
Agilent Technologies | Agilent Technologies: cat#240207 |
Used to blunt-end clone the gRNA scaffolds into the pSC-B plasmid |
| Commercial assay or kit | High-Capacity cDNA reverse transcription kit |
Applied Biosystems | 4368814 | |
| Array cards preloaded with primers |
384-well TLDA cards | Applied Biosystems | 43422489 | |
| Commercial assay kit | Taqman Gene expression master mix |
ThermoFisher Scientific | 4369016 | |
| Sequence-based reagent | shL3 flanking Fr primer | IDT | IDT: custom DNA oligo | Fr primer that flanks shL3 site; used to detect 41 nt shL3 deletion; 5’-TCTGGAATGGGAAGACACCT-3’ |
| Sequence-based reagent | shL3 flanking Rev primer | IDT | IDT: custom DNA oligo | Rev primer that flanks shL3 site; used to detect 41 nt shL3 deletion; 5’-CCTCCATCATCACCAGATCC-3’ |
| Sequence-based reagent | shL3 internal Rev primer | IDT | IDT: custom DNA oligo | Rev primer that overlaps with the shL3 site; used to detect 41 nt shL3 deletion; 5’-ATATACAAAGTACAGCCCAGT-3’ |
| Sequence-based reagent | shR6 flanking Fr primer | IDT | IDT: custom DNA oligo | Fr primer that flanks shR6 site; used to detect 227 nt shR6 deletion; 5’-GGTGTCATGCTGTGACTGTTG-3’ |
| Sequence-based reagent | shR6 flanking Rev primer | IDT | IDT: custom DNA oligo | Rev primer that flanks shR6 site; used to detect 227 nt shR6 deletion; 5’-TTTAGCTTAAGTGGCCAGCAA-3’ |
| Sequence-based reagent | shR6 internal Rev primer | IDT | IDT: custom DNA oligo | Rev primer that overlaps with the shR6 site; used to detect 227 nt shR6 deletion; 5’-AAGTTGGTTTACATCTGCAC-3’ |
| Sequence-based reagent | siL3 flanking Fr primer | IDT | IDT: custom DNA oligo | Fr primer that flanks siL3 site; used to detect 64 nt siL3 deletion; 5’-CTTGAGCAGTCAGCAACAGG-3’ |
| Sequence-based reagent | siL3 flanking Rev primer | IDT | IDT: custom DNA oligo | Rev primer that flanks siL3 site; used to detect 64 nt siL3 deletion; 5’-CAGAGGTTGGACAGGGAAGA-3’ |
| Sequence-based reagent | siL3 internal Rev primer | IDT | IDT: custom DNA oligo | Rev primer that is internal to the siL3 site; used to detect 64 nt siL3 deletion; 5’-ATATGGGTAATTGAAGGGCTG-3’. |
| Sequence-based reagent | siScr | IDT; Dharmacon | Dharmacon #D-001810-02-05 |
sense: UGGUUUACAUGUUGUGUGA |
| Sequence-based reagent | siL1 | Dharmacon | L-011130-00-0005 | sense: UACCAGUGCUGAUCAUUUA |
| Sequence-based reagent | siL1 | IDT | customer synthesis | sense: UACCAGUGCUGAUCAUUUA |
| Sequence-based reagent | siL2 | IDT | customer synthesis | sense: CAACGUAUCUGAGCUCUCU |
| Sequence-based reagent | siL3 | IDT | customer synthesis | sense: GCCCUUCAAUUACCCAUAU |
| Sequence-based reagent | siL3MUT | IDT | IDT #51-01-14-03 | sense: GGACUUCAACUAGACAUCU |
| Sequence-based reagent | siL4 | IDT | customer synthesis | sense: GGAAAGUGGCCCAUUUAAC |
| Sequence-based reagent | shL3 => siL3 | IDT | customer synthesis | sense: GACUGGGCUGU ACUUUGUAdTdA antisense: UACAAAGUACA GCCCAGUUdTdT |
| Sequence-based reagent | shR6 => siR6 | IDT | customer synthesis | sense: GGGUGCAGAU GUAAACCAAAdCdT; antisense: UUUGGUUUACA UCUGCACUUdTdT |
| Sequence-based reagent | Dsi-13.2 | IDT | customer synthesis | sense: AUCUU ACCAGUGC UGAUCAUUUAdTdA |
| Sequence-based reagent | Dsi-13.3 | IDT | customer synthesis | sense: AAAGUAUACUU CCGGGGUCAAUCdTdT |
| Sequence-based reagent | Dsi-13.9 | IDT | customer synthesis | sense: CUUCCGGGG UCAAUCUUGCAACAdAdC |
| Sequence-based reagent | Dsi-13.x | IDT | customer synthesis | sense: CAGGACUGAGAAG AAGUAAAACCdGdT |
| Sequence-based reagent | DsiL3 | IDT | customer synthesis | sense: CAGCCCUUCAAU UACCCAUAUCCdCdC |
| Sequence-based reagent | siScr pool | Dharmacon | D-001810–10 | |
| Sequence-based reagent | smartpool siRNA targeting NUCKS1 |
Dharmacon | L-014208–02 | |
| Sequence-based reagent | smartpool siRNA targeting CAPZA1 |
Dharmacon | L-012212–00 | |
| Sequence-based reagent | smartpool siRNA targeting CCT3 |
Dharmacon | L-018339–00 | |
| Sequence-based reagent | smartpool siRNA targeting FSTL1 |
Dharmacon | L-013615–00 | |
| Sequence-based reagent | smartpool siRNA targeting FUBP1 |
Dharmacon | L-011548–00 | |
| Sequence-based reagent | smartpool siRNA targeting GNB1 |
Dharmacon | L-017242–00 | |
| Sequence-based reagent | smartpool siRNA targeting NAA50 |
Dharmacon | L-014597–01 | |
| Sequence-based reagent | smartpool siRNA targeting PRELID3B |
Dharmacon | L-020893–01 | |
| Sequence-based reagent | smartpool siRNA targeting SNRPE |
Dharmacon | L-019719–02 | |
| Sequence-based reagent | smartpool siRNA targeting TFRC |
Dharmacon | L-003941–00 | |
| Sequence-based reagent | smartpool siRNA targeting HIST1H1C |
Dharmacon | L-006630–00 | |
| Sequence based reagent (human) |
GAPDH primer | Thermofisher Scientific | Hs00266705_g1 | |
| Sequence based reagent (human) |
CD95 primer | Thermofisher Scientific | custom probe | Fr primer: GGCTAACCCC ACTCTATGAATCAAT Rev primer: GGCCTGCCT GTTCAGTAACT Probe: CCTT TTGCTGAAATATC |
| Sequence based reagent (human) |
CD95 primer (Figure 5—figure supplement 3) |
Thermofisher Scientific | Hs00163653_m1 | |
| Sequence based reagent (human) |
CD95L primers | Thermofisher Scientific | Hs00181226_g1; Hs00181225_m1 |
|
| Sequence based reagent (human) |
shL3 target site in CD95L |
Thermofisher Scientific | custom probe | Fr primer: GGTGGCC
TTGTGATCAATGAAA Rev primer: GCAAGA TTGACCCCGGAAGTATA Probe: CTG GGCTGTACTTTGTATATT |
| Sequence based reagent (human) |
downstream of shL3 site | Thermofisher Scientific | custom probe | Fr primer: CCCC
AGGATCTGGTGATGATG Rev primer: ACTG CCCCCAGGTAGCT Probe: CCCAC ATCTGCCCAGTAGT |
| Sequence based reagent (human) |
GAPDH primer (TLDA card) |
Thermofisher Scientific | Hs99999905_m1 | |
| Sequence based reagent (human) |
ATP13A3 primer (TLDA card) |
Thermofisher Scientific | Hs00225950_m1 | |
| Sequence based reagent (human) |
CAPZA1 primer (TLDA card) |
Thermofisher Scientific | Hs00855355_g1 | |
| Sequence based reagent (human) |
CCT3 primer (TLDA card) |
Thermofisher Scientific | Hs00195623_m1 | |
| Sequence based reagent (human) |
FSTL1 primer (TLDA card) |
Thermofisher Scientific | Hs00907496_m1 | |
| Sequence based reagent (human) |
FUPB1 primer ( TLDA card) |
Thermofisher Scientific | Hs00900762_m1 | |
| Sequence based reagent (human) |
GNB1 primer (TLDA card) |
Thermofisher Scientific | Hs00929799_m1 | |
| Sequence based reagent (human) |
HIST1H1C primer (TLDA card) |
Thermofisher Scientific | Hs00271185_s1 | |
| Sequence based reagent (human) |
NAA50 primer (TLDA card) |
Thermofisher Scientific | Hs00363889_m1 | |
| Sequence based reagent (human) |
NUCKS1 primer (TLDA card) |
Thermofisher Scientific | Hs01068059_g1 | |
| Sequence based reagent (human) |
PRELID3B primer (TLDA card) |
Thermofisher Scientific | Hs00429845_m1 | |
| Sequence based reagent (human) |
SNRPE primer (TLDA card) |
Thermofisher Scientific | Hs01635040_s1 | |
| Sequence based reagent (human) |
TFRC primer (TLDA card) |
Thermofisher Scientific | Hs00951083_m1 | |
| Software | Stata 14 | Stata | RRID:SCR_012763 | |
| Software | Rstudio (R3.3.1) | Rstudio | RRID:SCR_000432 | |
| sequence based reagent | shScr | Sigma | SHC002V | Non-targeting shRNA control transduction particles |
| sequence based reagent (human) |
shL1 | Sigma | TRCN0000058998 | GCATCATCTTTGGAGAAGCAA |
| sequence based reagent (human) |
shL2 | Sigma | TRCN0000058999 | CCCATTTAACAGGCAAGTCCA |
| sequence based reagent (human) |
shL3 | Sigma | TRCN0000059000 | ACTGGGCTGTACTTTGTATAT |
| sequence based reagent (human) |
shL4 | Sigma | TRCN0000059001 | GCAGTGTTCAATCTTACCAGT |
| sequence based reagent (human) |
shL5 | Sigma | TRCN0000059002 | CTGTGTCTCCTTGTGATGTTT |
| sequence based reagent (human) |
shL6 | Sigma | TRCN0000372231 | TGAGCTCTCTCTGGTCAATTT |
| sequence based reagent (human) |
shL2' | Sigma | TRCN0000372232 | TAGCTCCTCAACTCACCTAAT |
| sequence based reagent (human) |
shL5' | Sigma | TRCN0000372175 | GACTAGAGGCTTGCATAATAA |
| sequence based reagent (human) |
shR2 | Sigma | TRCN0000218492 | CTATCATCCTCAAGGACATTA |
| sequence based reagent (human) |
shR5 | Sigma | TRCN0000038695 | GTTGCTAGATTATCGTCCAAA |
| sequence based reagent (human) |
shR6 | Sigma | TRCN0000038696 | GTGCAGATGTAAACCAAACTT |
| sequence based reagent (human) |
shR7 | Sigma | TRCN0000038697 | CCTGAAACAGTGGCAATAAAT |
| sequence based reagent (human) |
shR8 | Sigma | TRCN0000038698 | GCAAAGAGGAAGGATCCAGAT |
| sequence based reagent (human) |
shR27' | Sigma | TRCN0000265627 | TTTTACTGGGTACATTTTATC |
| sequence based reagent (human) |
shR7' | Sigma | TRCN0000255407 | TTAAATTATAATGTTTGACTA |
| sequence based reagent (human) |
shR8' | Sigma | TRCN0000255408 | ATATCTTTGAAAGTTTGTATT |
| sequence based reagent (human) |
shR6' | Sigma | TRCN0000255406 | CCCTTGTGTTTGGAATTATAA |