Table 1.
The mutations in congenital myasthenic syndrome genes identified in patients from Turkey
| Classification of CMS | Mutations | Published cases | References |
|---|---|---|---|
|
| |||
| Presynaptic | |||
| CHAT | c.1249G>A (1 case) | Yes | Schara U, et al. Eur J Ped Neurol. 2010; 14:326–333. |
| p.G417R | |||
| c.1007T>C (7 cases) | Yes | Schara U, et al. Eur J Ped Neurol. 2010; 14:326–333. | |
| p.I336T | Yis U, et al. J Child Neurol. 2009; 24:895–898. | ||
| MYO9A | c.5093A>G (2 cases) | O’Connor, et al. Brain 2016; 139:2143–2153. E | |
| p.D1698G | |||
|
| |||
| Synaptic basal lamina associated | |||
| COLQ | c.444G>A (7 cases) | Yes | Güven A, et al. Pediatr Neurol. 2012; 46:253–256. |
| p.W148* | Wargon I, et al. Neuromuscul Disord. 2012; 22:318–324. | ||
| Halilioğlu G, et al. 2016; 26:S112 | |||
| c.1082delC (2 cases) | Yes | Mihaylova V, et al. Brain 2008; 131:747–759. | |
| p.P361Lfs*64 | Duran GS, et al. Acta Neurol Belg. 2013; 113:531–532. | ||
| c.706C>T (1 case) | Yes | Mihaylova V, et al Brain 2008; 131:747–759. | |
| p.R236* | |||
| c.1281C>T (1 case) | Yes | Wargon I, et al. Neuromuscul Disord. 2012; 22:318–324. | |
| p.C427= (splice mutation) | |||
| c.679C>T (1 case) | Yes | Wargon I, et al. Neuromuscul Disord. 2012; 22:318–324. | |
| p.R227* | |||
| c.1169A>G (1 case) | No (this study) | ||
| p.N390S | |||
| c.444G>A/c.706C>T (1 case) | No (this study) | ||
| p.W148*/p.R236* | |||
|
| |||
| Defects in AchR | |||
| CHRNE | ε1206ins19 (2 cases) | Yes | Ohno K. Ann Neurol. 1998; 44:234–241. |
| (c.1248_1266dup19)## | |||
| ε70insG (2 cases) | Yes | Ohno K. Ann Neurol. 1998; 44:234–241. | |
| (c.130dupG)## | |||
| ε70insG/εIVS7+2T>C (1 case) | Yes | Ohno K. Ann Neurol. 1998; 44:234–241. | |
| (c.130dupG/c.802+2T>C)## | |||
| ε1276delG (4 cases) | Yes | Ohno K. Ann Neurol. 1998; 44:234–241. | |
| (c.1336delG)## | |||
| ε59ins5 (2 cases) | Yes | Ohno K. Ann Neurol. 1998; 44:234–241. | |
| (c.115_119dup5)## | |||
| c.393C>G (1 case) | No (this study) | ||
| p.Y131* | |||
| c.803-2A>G (1 case) | No (this study) | ||
| c.1327delG/c.1319_1326+15del23§§ (1 case) | No (this study) | ||
| CHRND | c.991C>T (1 case) | No (this study) | |
| p.L331F | |||
|
| |||
| Defects in endplate development and maintenance | |||
| AGRN | c.5023G>A (1 case) | Yes | Karakaya M, et al. Neuromuscul Disord. 2014; 24:843. |
| p.G1675S | |||
| MUSK | c.114T>A (2 cases) | Yes | Gallenmüller C, et al. Neuromuscul Disord. 2014; 24:31–35. |
| p.D38E | |||
|
| |||
| The origin of neurotransmission defect is unknown | |||
| GFTP1 | c.686-2A>G (1 case) | No (this study) | |
##
: annotation according to the HGVS guidelines
§§
: c.1319_1326+15delCCGGCGAGGTGGGACAGGAGCCA