Table 6.

Basaloid squamous cell carcinoma NGS results

Case #	Pathogenic Mutations	CNVs	MYB FISH Results
1	FBXW7 c.1513C>A (p.R505S) - in 23% of 327 reads KIT c.1540G>T (p.E514*) - in 19% of 197 reads TET2 c.4354C>T (p.R1452*) - in 22% of 283 reads	3p11.1-3p22.1 loss 3q12.3-3q27.3 loss 11q14.2-11q23.3 loss 13q12.2-13q33.1 loss	Normal
2	TP53 c.568C>A (p.P190T) - in 65% of 136 reads EED c.322_323insGA (p.D109Efs*4) - in 51% of 446 reads ARID1B c.956G>T (p.G319V) - in 62% of 27 reads FGFR1 c.1615G>A (p.G539R) - in 48% of 286 reads IKZF3 c.244G>A (p.E82K) - in 51% of 346 reads KDM6B c.485C>T (p.S162F) - in 15% of 106 reads	Complex gains and losses involving chromosomes 1, 2, 3, 4, 6, 8, 9, 10, 11, 12, 13, 14, 16, and 17	Polysomy
3	TP53 c.404G>A (p.C135Y) - in 91% of 275 reads GNAQ c.524C>T (p.T175M) - in 47% of 270 reads KDM5C c.1879C>T (p.R627C) - in 94% of 100 reads PIK3CA c.652G>C (p.E218Q) - in 30% of 725 reads STAG1 c.3595G>A (p.E1199K) - in 19% of 575 reads	Complex gains and losses involving chromosomes 2, 3, 5, 7, 8, 9, 11, 13, 14, 15, 16, 17, 18, 20, and X	Polysomy
4	TP53 c.482C>A (p.A161D) - in 67% of 369 reads	Complex gains and losses involving chromosomes 2, 3, 4, 5, 7, 8, 9, 11, 12, 14, 15, 17, 19, 20, and X	Polysomy
5	None	Complex gains and losses involving chromosomes 1, 2, 3, 4, 5, 9, 10, 11, 12, 13, and 18	Normal
6	TP53 c.503_525delACATGACGGAGGTTGTGAGGCGC (p.H168Lfs*5) - in 22% of 413 reads CDKN2A c.172C>T (p.R58*) - in 33% of 105 reads CDKN2A c.238C>T (p.R80*) - in 25% of 185 reads SMARCA4 c.3403C>G (p.R1135G) - in 26% of 230 reads CYLD c.1609_1610delAA (p.K537Efs*5) - in 30% of 383 reads	Complex gains and losses involving chromosomes 1, 3, 4, 5, 6, 8, 9, 11, 14, 16, 19, and 20	Polysomy
7	None	Complex gains and losses involving chromosomes 4, 6, 9, 10, 11, 12, 14, 16, 18, and 20	Normal
8	TP53 c.216delC (p.V73Wfs*50) - in 64% of 139 reads NOTCH2 c.4822A>T (p.R1608*) - in 39% of 307 reads	Complex gains and losses involving chromosomes 1, 2, 3, 4, 6, 7, 8, 9, 11, 12, 13, 14, 15, 16, 17, 18, 19, and 20	Polysomy
9	FBXW7 c.1394G>A (p.R465H) - in 33% of 254 reads FGFR3 c.746C>G (p.S249C) - in 34% of 246 reads KMT2D c.166C>T (p.Q56*) - in 31% of 360 reads	3q12.3-3q27.3 gain 4q31.3 gain 6p21 loss 6q15-6q26 loss 13q13.1-33.1 loss 20q11.21-13.32 gain	Monosomy
10	TP53 c.783-20_795del TCTTTTCCTATCCTGAGTAGTGGTAATCTACTG - in 11% of 102 reads NOTCH1 c.7244_7246delCAC (p.P2415del) - in 6% of 131 reads PIK3CA c.1633G>A (p.E545K) - in 17% of 680 reads SMAD4 c.1333C>T (p.R445*) - in 57% of 157 reads	Complex gains and losses involving chromosomes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 21, and X	Normal
11	NOTCH1 c.6321delC (p.H2107Qfs*4) - in 19% of 338 reads	Complex gains and losses involving chromosomes 1, 2, 3, 5, 6, 9, 12, 13, 16, 17, 19, 20, 22, and X	Polysomy
12	TP53 c.1010G>T (p.R337L) - in 85% of 204 reads ARID1A c.465_471delCCGGAGC (p.S157Lfs*73) - in 36% of 226 reads KMT2D c.8401C>T (p.R2801*) - in 41% of 360 reads	Complex gains and losses involving chromosomes 1, 2, 3, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 17, 18, 19, 20, and X	Polysomy
13	TCF7L1 c.1071G>A (p.M357I) - in 25% of 329 reads	Low copy number gains and losses involving chromosomes 1, 3, 4, 16, 20, 22, and X	Rearranged (66% of nuclei)

Average read coverage, NOTCH1: exon 25, 230 (range 133–422); exon 26, 196 (range 123–361); exon 27, 282 (range 181–505); exon 28, 222 (range 120–376); exon 34, 182 (range 113–311)