Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2018 Nov 15.
Published in final edited form as: Dev Biol. 2017 Sep 9;431(2):239–251. doi: 10.1016/j.ydbio.2017.09.011

bHLH-O proteins balance the self-renewal and differentiation of Drosophila neural stem cells by regulating Earmuff expression

Xiaosu Li 1, Rui Chen 1, Sijun Zhu 1,*
PMCID: PMC5658246  NIHMSID: NIHMS906418  PMID: 28899667

Abstract

Balancing self-renewal and differentiation of stem cells requires differential expression of self-renewing factors in two daughter cells generated from the asymmetric division of the stem cells. In Drosophila type II neural stem cell (or neuroblast, NB) lineages, the expression of the basic helix-loop-helix-Orange (bHLH-O) family proteins, including Deadpan (Dpn) and E(spl) proteins, is required for maintaining the self-renewal and identity of type II NBs, whereas the absence of these self-renewing factors is essential for the differentiation of intermediate neural progenitors (INPs) generated from type II NBs. Here, we demonstrate that Dpn maintains type II NBs by suppressing the expression of Earmuff (Erm). We provide evidence that Dpn and E(spl) proteins suppress Erm by directly binding to C-sites and N-boxes in the cis-regulatory region of erm. Conversely, the absence of bHLH-O proteins in INPs allows activation of erm and Erm-mediated maturation of INPs. Our results further suggest that Pointed P1 (PntP1) mediates the dedifferentiation of INPs resulting from the loss of Erm or overexpression of Dpn or E(spl) proteins. Taken together, these findings reveal mechanisms underlying the regulation of the maintenance of type II NBs and differentiation of INPs through the differential expression of bHLH-O family proteins.

Keywords: Drosophila, neuroblast, intermediate neural progenitor, b-HLH, Deadpan, E(spl)

Introduction

During the development of the nervous system, neural stem cells (NSCs) need to maintain their own population to generate a large number of various types of neurons and glia. To this end, NSCs undergo asymmetric self-renewing divisions, enabling the generation of new NSCs and production of fate-restricted progenitor cells or post-mitotic neurons/glia. The acquisition of distinct cell fates of the two daughter cells generated from the asymmetric division requires the unequal inheritance of cell fate determinants and differential expression of self-renewing factors. Such asymmetric expression of cell fate determinants and self-renewing factors is critical not only for maintaining the NSC population but also for avoiding tumorigenesis (Neumuller and Knoblich, 2009; Paridaen and Huttner, 2014).

In both vertebrates and invertebrates, basic helix-loop-helix-Orange (bHLH-O) family proteins play important roles in maintaining NSC self-renewal (Imayoshi and Kageyama, 2014; Zacharioudaki et al., 2012; Zhu et al., 2012). The bHLH-O proteins are transcriptional repressors that contain a bHLH DNA-binding domain and a distinctive “Orange” dimerization domain (Davis and Turner, 2001; Fisher and Caudy, 1998). In vertebrates, a subfamily of bHLH-O proteins called Hes proteins, which are homologs of Drosophila Hairy and Enhancer of split [E(spl)] proteins, are highly expressed in neural epithelial cells and radial glia cells. In the absence of Hes proteins, radial glial cells prematurely differentiate into neurons, resulting in the premature depletion of radial glial cells and a hypoplastic nervous system. Conversely, the misexpression of Hes proteins inhibits neuronal differentiation (Hatakeyama et al., 2004; Ishibashi et al., 1995; Ohtsuka et al., 1999). Hes proteins maintain radial glial cells by inhibiting the expression of proneural genes such as Mash1 and Neurogenin 2 (Ngn2), which promote neuronal differentiation (Imayoshi and Kageyama, 2014; Ishibashi et al., 1995).

In Drosophila, there are total 13 members of the bHLH-O protein family. Among these proteins, Deadpan (Dpn) and at least three members of the E(spl) complex, including E(spl)mγ, E(spl)mβ, and E(spl)m8, are expressed in neuroblasts (NBs, the Drosophila NSCs) but not in their differentiating daughter cells generated from asymmetric division (Bier et al., 1992; Zacharioudaki et al., 2012). E(spl)mγ and m8 are activated through Notch signaling, but Dpn functions independently (Zacharioudaki et al., 2012; Zhu et al., 2012). Functional analyses revealed that Dpn and Notch signaling are crucial for maintaining NBs. In Drosophila larval brains, there are two different types of NBs, type I and type II. Type I NBs produce terminally dividing ganglion mother cells (GMCs) and also divide to self-renew, whereas type II NBs produce intermediate neural progenitor cells (INPs) (Bello et al., 2008; Boone and Doe, 2008; Bowman et al., 2008). INPs undergo several rounds of asymmetric self-renewing divisions, similar to type I NBs, to produce GMCs after these cells differentiate from an immature status to a mature status. Interestingly, type II NB lineages are more sensitive to the changes of Dpn or Notch signaling. In the absence of Dpn or Notch signaling, type II NBs are completely eliminated, but type I NBs are not (Bowman et al., 2008; San-Juan and Baonza, 2011; Zacharioudaki et al., 2012; Zhu et al., 2012). Furthermore, type II NBs are transformed into type I-like NBs in the absence of Dpn or Notch signaling before these cells are lost (Zhu et al., 2012). When Dpn is overexpressed or Notch signaling is overactivated by expressing the intracellular domain of Notch (Nintra) or its target E(spl) proteins, type II NBs also show much more severe overproliferation than type I NBs due to dedifferentiation of immature INPs (imINPs) (Bowman et al., 2008; Zacharioudaki et al., 2012; Zhu et al., 2012).

We recently demonstrated that Notch maintains type II NBs at least in party by activating the canonical pathway for the expression of E(spl) proteins, which in turn suppresses the activation of earmuff (erm) by Pointed P1 (PntP1) (Li et al., 2016). PntP1 is expressed in type II NBs and imINPs to specify type II NBs and promote the generation of INPs by preventing both the dedifferentiation and premature differentiation of INPs (Xie et al., 2016; Zhu et al., 2011). Erm is normally activated by PntP1 only in imINPs, in which Notch is turned off (Koe et al., 2014; Xie et al., 2016). In the absence of Notch or its downstream E(spl) proteins, PntP1 activates erm in type II NBs. The ectopically expressed Erm exerts a negative feedback on PntP1 by inhibiting its function and expression, resulting in transformation of type II NBs into type I-like NBs. Additionally, the ectopically expressed Erm promotes the termination of type II NB self-renewal through an unknown mechanism (Li et al., 2016). However, it remains unclear how Dpn maintains type II NBs and how Dpn overexpression or Notch overactivation leads to the tumorigenic overproliferation of type II NBs.

Similar to E(spl) proteins, Dpn functions as a transcriptional repressor by binding to similar DNA sequences (Fisher and Caudy, 1998; Paroush et al., 1994). Given that Dpn and Notch show similar loss-of-function and gain-of-function phenotypes in type II NB lineages, we hypothesize that Dpn maintains type II NBs by similarly suppressing erm expression in type II NBs and the absence of Dpn as well as E(spl) proteins in imINPs allows activation of erm and Erm-mediated maturation of INPs. Here, we test this hypothesis by examining how the manipulation of Dpn and E(spl) protein expression would affect Erm expression and how changes in Erm expression contribute to the defects of type II NB lineage development that result from changes in Dpn expression or Notch signaling.

MATERIALS AND METHODS

Fly stocks

GAL4 lines used for transgene expression include pntP1-GAL4 (or GAL414–94) (Zhu et al., 2011), erm-GAL4 (II) (Xiao et al., 2012), and insc-GAL4 (Betschinger et al., 2006). UAS transgenes for RNAi knockdown or overexpression include UAS-erm RNAi (#26778, Bloomington Drosophila Stock Center, Bloomington, IN, USA [BDSC]), UAS-dpn RNAi (BDSC, #51440), UAS-rCD2 RNAi (BBSC, #56169) (Yu et al., 2009), UAS-numb RNAi (BDSC, #35045), UAS-E(spl)m5 (BDSC, #26680), UAS- E(spl)m7 (BDSC, #26681), UAS- E(spl)m8 (BDSC, #26872 and #26873), UAS-E(spl)mβ (BDSC, #26675), UAS-E(spl)mδ (BDSC, #26677), UAS-Nintra (BDSC, #52008), UAS-dpn (Wallace et al., 2000), and UAS-erm (Weng et al., 2010). R9D11-CD4-tdTomato (Han et al., 2011) was used as an erm reporter. dpn1 (Younger-Shepherd et al., 1992), dpn7 (Barbash and Cline, 1995), erm, and erm2 mutant alleles (Weng et al., 2010) were used for mutant phenotypic analyses.

RNAi knockdown and transgene expression

RNAi knockdown experiments were carried out at 29°C in order to maximize the efficiency. Misexpression or overexpression of UAS-transgenes was conducted at 29°C. tub-GAL80ts (McGuire et al., 2003) was used in combination with specific GAL4 lines for temporal control of RNAi knockdown or misexpression/overexpression. Animals were shifted from 18°C to 29°C for inactivating GAL80ts at specific temporal windows.

Electrophoretic mobility shift assays (EMSA)

Coding regions of seven E(spl) genes and dpn were amplified by using Q5 Hot Start High-Fidelity DNA Polymerase (Catalog #M0491, New England BioLabs Inc., Ipswich, MA). The amplified products were cloned into pcDNA™3.1/His expression vectors (Catalog #V38520, Life Technologies Co., Grand Island, NY). All proteins are expressed from the pcDNA™3.1/His construct using the TNT® T7 Quick Coupled Transcription/Translation kit (Catalog #L1170, Promega Co., Madison, WI) according to manufacturer’s instructions. A 20-nt sequence flanking the bHLH-O3 was chosen as a probe, which was labeled with Cy5 at the 5’-end of both strands. The binding reaction was performed by incubating 0.05 pmol of cy5-bHLH-O3 with 2µl TNT-T7 expressing product. To determine the binding specificity, the same unlabeled bHLH-O3 (bHLH-O3S) was used as a specific competitor and the unlabeled bHLH-O3 containing mutations of two nucleotides in the C-site (bHLH-O3NS) as a non-specific competitor. To investigate if the other two sites can bind to E(spl) or Dpn proteins, unlabeled probes containing 20-nt sequences from bHLH-O1 or bHLH-O2 were used to compete with Cy5-bHLH-O3 for the binding. Competitions were performed with 2 pmol of unlabeled bHLH-O3S, bHLH-O3NS, bHLH-O1, or bHLH-O2 probes. Proteins were preincubated with competitors for 10 minutes at room temperature followed by 20-minute incubation with Cy5-bHLH-O3. 10µl of EMSA reactions were analyzed on 5% nondenaturing polyacrylamide Mini-PROTEAN® TBE gels, which were scanned with ChemiDoc™ XRS. Sequences of the oligonucleotide probes used in the EMSA are listed below. All probes were synthesized by Integrated DNA Technologies (Carolville, IA) and annealed to form double-strand DNAs.

  • Cy5-bHLH-O3: Cy5-CCGGTGGCACGCGCCTTTAT

  • bHLH-O3S: CCGGTGGCACGCGCCTTTAT

  • bHLH-O3NS: CCGGTGGtAtGCGCCTTTAT

  • bHLH-O1: AGCTGGCACGAGCCAATT

  • bHLH-O2: CTTGAGCGCGTGCCGTGC

Construction of plasmids and generation of transgenic lines for erm reporters

The gateway cloning system was used for cloning erm enhancer fragments listed in Figure 4 (including R9D11, B, R1, and R2) into pDEST-HemmarR vector (Han et al., 2011), which allows these enhancer fragments to drive the expression of CD4-tdTomato. Briefly, erm enhancer fragments were amplified by PCR from genomic DNAs and cloned into the donor vector pDONR221 first by BP reactions to make entry clones pENTR-R9D11, B, R1, and R2. LR reactions were then carried out between the entry clones and the pDEST-HemmarR destination vectors to make pHemmarR- R9D11, B, R1, and R2. To clone erm enhancer fragments with deletion of specific binding sites (R9D11ΔbHLH-O3, R9D11ΔbHLH-O123) into the pDEST-HemmarR vector, overlapping PCR was used to remove the E(spl)/Dpn binding sites from the pENTR- R9D11 vector. R9D11 enhancer fragments with deletion of specific bHLH-O binding sites were then cloned into pDEST-HemmarR by LR reactions. All constructs were integrated into the attP2 site on the third chromosome by injecting constructs into P{y[+t7.7]=CaryP} attP2 embryos. Primers used for making these reporter lines are listed below with the 5’-end on the left.

  • R9D11-forward: GAAGTCCAACGCGCTATC

  • R9D11-reverse: GCTGCGGTTTGCTATGAT

  • B-forward: CGAAATCAAATGTCAGGCCAGT

  • B-reverse: GTCAATTTCTGCGGCTAACCAA

  • R1-forward: GAAGTCCAACGCGCTATC

  • R1-reverse: ACCGGAAGTAAGTGGAAGCCAA

  • R2-forward: GAAGTCCAACGCGCTATC

  • R2-reverse: CTGGAAAGAAAAGGGGGAGGTG

  • R9D11ΔbHLH-O-1-forward: ACAAGCAAGCATTTAGAATGCCAAATTCG

  • R9D11ΔbHLH-O-1-reverse: CATTCTAAATGCTTGCTTGTAATGCGAG

  • R9D11ΔbHLH-O-2-forward: GCATGTCCTTTGCGTCCTTAGGAGACCT

  • R9D11ΔbHLH-O-2-reverse: TAAGGACGCAAAGGACATGCGAGCAGTA

  • R9D11ΔbHLH-O-3-forward: AAATTGAACGCCGCCGGTTTATTGGCTCATCTTCC

  • R9D11ΔbHLH-O-3-reverse: GGAAGATGAGCCAATAAACCGGCGGCGTTCAATTT

Figure 4. bHLH-O binding sites mediate the suppression of erm in type II NBs.

Figure 4

Open in a new tab

(A) A schematic diagram shows DNA fragments from the erm enhancer region that were used to drive the expression of CD4-tdTom. TSS: transcription start site. (B–H) Expression of the CD4-tdTom reporter driven by individual erm enhancer fragments in type II NB lineages labeled with mCD8-GFP. Arrowheads and arrows point to type II NBs with or without CD4-tdTom expression, respectively. (I) Percentages of type II NBs with the expression of CD4-tdTom driven by individual erm enhancer fragments. Numbers in parenthesis are the number of brain lobes examined.

Immunostaining and confocal microscopy

Larval brains were dissected and immunostained as described (Lee and Luo, 1999). Primary antibodies include rabbit anti-Dpn (1:500) (Bier et al., 1992), guinea pig anti-Ase (1:5000) (Brand et al., 1993) (gifts from Y. N. Jan), rat anti-Erm (gift from C. Desplan, 1:100), rat antimCD8 (clone #5H10, Life Technologies Co., Grand Island, NY; 1:100), rabbit anti-dsRed (Catalog #632392, Clontech; 1:500), and chicken anti-GFP (catalog #GFP-1020, Aves Labs, Tigard, OR; 1:1000). Secondary antibodies conjugated to Dylight 488, Cy3 or Dylight 647 (Jackson ImmunoResearch) were used at 1:100, 1:500, or 1:500, respectively. Images were taken with a Zeiss 780 confocal microscope and processed with Adobe Photoshop. Two-tailed t-tests were used for statistical analyses.

RESULTS

Loss of Dpn leads to ectopic activation of erm in type II NBs

To determine whether Dpn maintains type II NBs by suppressing Erm expression, we first examined Erm expression in Dpn knockdown or dpn1/dpn7 trans-heterozygous mutant type II NBs using R9D11-CD4-tdTomato (abbreviated as R9D11-tdTom) as a reporter. R9D11-tdTom utilizes a 3.9kb DNA enhancer fragment R9D11 from the erm to drive the expression of CD4-tdTomato and shows a similar expression pattern as endogenous Erm proteins (Han et al., 2011; Pfeiffer et al., 2010). In wild-type larvae, there are 8 type II NBs/brain lobe, which can be distinguished from type I NBs by the lack of the proneural protein Asense (Ase) (Figure 1A–A”, D) (Bello et al., 2008; Boone and Doe, 2008; Bowman et al., 2008). We previously showed that in dpn mutants, the majority of type II NBs were lost by the mid-1st instar larval stage and the remaining type II NBs were transformed into type I-like NBs as indicated by ectopic Ase expression in the NBs (Figure 1C–C”, D) (Zhu et al., 2012). Knocking down Dpn using the type II NB-specific driver pntP1-GAL4 (Zhu et al., 2011) led to a similar loss of type II NBs and transformation of type II NBs into type I-like NB as in dpn mutant animals. By 20 hours after larval hatching (ALH), only approximately 5 type II NBs per brain lobe were observed when Dpn was knocked down, and 81% of the remaining type II NBs ectopically expressed Ase (Figure 1B–B”, D). Interestingly, R9D11-tdTom, which is only expressed in imINPs but not in type II NBs in wild-type larvae (Figure 1A–A”), was ectopically expressed in both Dpn knockdown and dpn mutant type II NBs at the 1st instar larval stage (Figure 1B–C”). Consistently, endogenous Erm protein was also ectopically expressed in Dpn knockdown type II NBs (Supplementary Figure S1). These results demonstrate that the erm is ectopically activated in type II NBs in the absence of Dpn.

Figure 1. Loss of Dpn leads to ectopic Erm expression in type II NBs.

Figure 1

Open in a new tab

Type II NB lineages are labeled with mCD8-GFP driven by PntP1-GAL4 in all panels. Arrows point to type II NBs. (A–B”) R9D11-tdTom and Ase are ectopically expressed in Dpn knockdown (B–B”) but not wild-type (A–A”) type II NBs at 20 hours ALH. (C–C”) Most type II NBs are lost in dpn1/7 mutant larval brains at 8–16 hours ALH and the remaining type II NBs express R9D11-tdTom and Ase. (D) Quantifications of the number of type II NBs in wild-type and Dpn knockdown brains at 20 hours ALH and dpn mutant brains at 8–16 hours ALH. Numbers on top of each bar in this and all other bar graphs represent sample sizes. ***, P < 0.01. (E–F’) Knocking down Dpn after the 1st instar larval stage abolishes Dpn expression (E–E’) and ectopically activates R9D11-tdTom in type II NBs (F–F’) at 4 days ALH.

Our previous studies, among others have shown that the loss of type II NBs resulting from the loss of Dpn only occurs during the 1st instar larval stage but not at later larval stages. In dpn mutant type II NB clones induced after reactivation of NBs, type II NBs are neither lost nor transformed into type I-like NBs, even at late 3rd instar larval stages (Zhu et al., 2012). One proposed reason is that Notch signaling, which is activated in reactivated NBs, functions redundantly in maintaining type II NBs (Zacharioudaki et al., 2012). Thus, we examined whether the ectopic activation of erm resulting from the loss of Dpn only occurred in quiescent type II NBs but not in proliferating cells. To address this question, we knocked down Dpn at 1 day ALH when all type II NBs were reactivated. We used the temperature-sensitive GAL80 under the control of the tubulin promoter (tub-GAL80ts) (McGuire et al., 2003) for the temporal control of the expression of UAS-dpn RNAi. Using this approach, we abolished Dpn expression at 4 days ALH (Figure 1E–E’). Surprisingly, we still observed the ectopic expression of R9D11-tdTom in type II NBs at 4 days ALH (Figure 1F–F’). However, the expression level was much weaker than that in Dpn knockdown or dpn mutant type II NBs at 1st instar larval stages. Furthermore, we did not observe any loss of type II NBs or ectopic Ase expression in the NBs (Figure 1F), indicating that the expression level of the ectopically expressed Erm may not be sufficient to induce the transformation of type II NBs into type I-like NBs or premature loss of type II NBs. These results suggest that both Dpn and Notch signaling are required to completely suppress Erm expression in type II NBs and these molecules may not be totally functionally redundant.

Removing Erm prevents the transformation and premature loss of type II NBs resulting from the loss of Dpn

Misexpression of Erm in type II NBs is detrimental. It not only terminates NB self-renewal prematurely through a yet-to-be-identified mechanism but also transforms type II NBs into type I-like NBs by inhibiting PntP1 activity and expression (Li et al., 2016; Weng et al., 2010). Therefore, we next examined whether the transformation and premature loss of type II NBs resulting from the loss of Dpn was due to the ectopic activation of erm in type II NBs. We addressed this question by generating dpn erm double mutants or simultaneously knocking down Dpn and Erm in type II NBs using pntP1-GAL4 as a driver. We first examined type II NBs in dpn erm double mutants at 20–24 hours ALH. At this stage, nearly all type II NBs were lost in dpn mutants (Figure 2A–B, M). However, in erm dpn double mutants, we could still observe 7–8 Ase− type II NBs in each brain lobe (Figure 2D, M), suggesting that in the absence of Erm, dpn mutant type II NBs maintained their self-renewal and cellular identities. Similarly, simultaneous knockdown of Erm almost completely recovered the loss of type II NBs resulting from Dpn knockdown. There were similar numbers of Ase− type II NBs in Erm Dpn double knockdown brains and Erm knockdown brains at 4 days ALH, which is in stark contrast to the complete loss of Ase− type II NBs in Dpn knockdown brains at the same stage (Figure 2E–H, N).

Figure 2. Ectopic Erm expression is responsible for the premature loss of type II NBs resulting from loss of Dpn.

Figure 2

Open in a new tab

(A–D) dpn mutant type II NBs are maintained in erm mutant background. Type II NBs, which are identified as Dpn+ Ase− cells (arrows), are completely lost in dpn mutant brains (B) but are still present in erm dpn double mutants (D) as in the wild-type (A) or erm mutant (C) brains at 20–24 hours ALH. Note that there is an increased number of type II NBs in erm mutant brains (C). (E–H) Knockdown of Erm rescues the loss of type II NBs resulting from Dpn knockdown. Type II NBs labeled by mCD8-GFP are present in wild-type (E) but not in Dpn knockdown brains (F) at 4 days ALH. However, the number of type II NBs in Erm Dpn double knockdown brains (H) is comparable to that in Erm knockdown brains (G) at 4 days ALH. (I–L) Removing Erm restores the number of type II NBs and pntP1-GAL4 expression in newly hatched dpn1/7 mutant larval brains. Type II NBs are largely lost in dpn mutant brains (J) at 0–4 hours ALH and the remaining type II NBs ectopically express R9D11-tdTom and have reduced expression levels of mCD8-GFP driven by pntP1-GAL4 compared with that in wild-type brains (I). In erm dpn double mutants (L), type II NBs and their expression of mCD8-GFP expression are still maintained as in the wild-type (I) or erm mutant brains (K) but R9D11-tdTom is still ectopically expressed in the NBs. Insets show mCD8-GFP expression in highlighted type II NBs. (M–N) Quantifications of the number of type II NBs in larval brains with indicated genotypes at 0–4 hours or 20–24 hours ALH (M) or 4 days ALH (N). ***, P < 0.01.

Since increased numbers of type II NBs in erm mutant or Erm knockdown brains were observed (Figure 2C, G, M, N), one might argue that the recovery of type II NBs could be due to dedifferentiation of INPs resulting from the loss of Erm. Therefore, we also examined type II NBs in erm dpn double mutant brains immediately after larval hatching when type II NBs are still quiescent. We reasoned that if type II NBs were not actively dividing to produce INPs, then the loss of Erm would not lead to the dedifferentiation of INPs or an increased number of type II NBs. Since quiescent type I NBs in newly hatched larvae do not express Ase either, we used mCD8-GFP driven by pntP1-GAL4 to label type II NBs. We observed that similar to wild-type, there were still only 8 type II NBs in erm mutants at 0 – 4 hours ALH, but the number of type II NBs had reduced to 5/brain lobe in dpn mutants at the same stage (Figure 2I–K, M). These remaining type II NBs in dpn mutants ectopically expressed R9D11-tdTom and showed markedly reduced expression of mCD8-GFP driven by pntP1-GAL4 (Figure 2J) likely due to the inhibitory effect of ectopically expressed Erm on pntP1 expression (Li et al., 2016). However, in erm dpn double mutants, the number of type II NBs remained the same as that in wild-type and the expression level of mCD8-GFP driven by pntP1-GAL4 was also restored (Figure 2L–M), suggesting that the rescue of type II NBs in dpn erm double mutant or Dpn Erm double knockdown brains observed at later developmental stages is not due to dedifferentiation of INPs. These results demonstrate that the transformation and premature loss of type II NBs resulting from the loss of Dpn is at least in part due to the ectopic activation of erm in type II NBs.

Dpn and E(spl) proteins directly bind to the cis-regulatory region of the erm gene

Dpn and Notch downstream targets, E(spl) proteins, are Hes family proteins that function as transcriptional repressors and preferentially bind to DNA sequences containing the N-box (CACNAG) or the class C-site [CACG(C/A)G] (Kageyama et al., 2007; Oellers et al., 1994; Winston et al., 1999) {Fisher, 1998 #379;Winston, 1999 #416;Winston, 1999 #416}. To investigate how Dpn and E(spl) proteins suppress Erm expression in type II NBs and determine which E(spl) proteins might mediate the suppression of erm by the Notch signaling, we next examined whether Dpn and E(spl) proteins directly bind to the erm regulatory region and whether different E(spl) proteins show distinct binding affinities. We first searched for potential Dpn/E(spl) binding sites in the R9D11 enhancer region using the FlyFactorSurvey (http://mccb.umassmed.edu/ffs/) and the Target Explorer (http://te.cryst.bbk.ac.uk/). We detected three putative Dpn/E(spl) binding sites located at −9,463, −8,424, and −7,456 bps from the transcription start site, which contained consensus sequences of the N-box or C-site and were named as bHLH-O1, bHLH-O2, and bHLH-O3, respectively (Figure 3B, Figure 4A). These putative binding sites are well conserved among different Drosophila species (data not shown), suggesting that they could function as bona fide Dpn/E(spl) binding sites. We then performed gel mobility shift assays to determine whether Dpn or any E(spl) proteins could directly bind to these putative sites. We first used a Cy5-labeled 20 bp DNA fragment containing the bHLH-O3 as a probe (Cy5-bHLH-O3) (Figure 3B). We observed that Dpn as well as five E(spl) proteins, including E(spl)m3, E(spl)m7, E(spl)mβ, E(spl)mδ, and E(spl)mγ, could bind to the probe, as indicated by the presence of retarded Cy5-labeled bands (Figure 3A, C). The observed binding appeared to be specific, as non-labeled probes with the same sequence (bHLH-O3-S) could compete for the binding (“S” in Figure 3C) but probes with mutations in the C-site (bHLH-O3-NS) could not (“NS” in Figure 3C). However, different from other E(spl) proteins, E(spl)m5 and E(spl)m8 did not bind to Cy5-bHLH-O3 (Figure 3A, C). Comparison of amino acid sequences of the bHLH domain of Dpn and E(spl) proteins revealed that E(spl)m5 and E(spl)m8 are more distantly related to other E(spl) proteins or Dpn (Figure 3A), suggesting that E(spl)m5 and E(spl)m8 might bind to different DNA sequences.

Figure 3. Dpn and E(spl) proteins directly bind to the erm regulatory region.

Figure 3

Open in a new tab

(A) Dpn and seven E(spl) proteins can be classified into three subfamilies (left) based on the amino acid sequence similarity of their bHLH domains, which were aligned using ClustalW on the right. “+” and “−” indicate their binding to the bHLH-O3 in the R9D11 region. (B) Three predicted Dpn/E(spl) binding sites (bHLH-O1, bHLH-O2, and bHLH-O3) in the R9D11 region. Probe sequences used for the gel-shift assays are shown on top of individual binding sites with the core putative Dpn/E(spl) binding sequences indicated in red. Sequences of the N-box in bHLH-O1 and the C-sites in bHLH-O2 and bHLH-O3 are underlined. Note that the C-site sequence in bHLH-O2 is in a reverse orientation. The two mutated nucleotides in the probe bHLH-O3NS are shown in green. TSS: transcription start site. (C) Gel-shift assays show E(spl)m3, m7, mβ, mδ, mγ, and Dpn, but not E(spl)m5 or m8, bind to the cy5-labeled bHLH-O3 probe. The Non-labeled wild-type probe bHLHL-O3S (S) is used as a specific competitor and the non-labeled mutant probe bHLH-O3NS (NS) as a non-specific competitor. (D) The binding of E(spl) and Dpn proteins to the probe Cy5-bHLH-O3 is completely abolished in the presence of the non-labeled probe bHLH-O1 but is only reduced in the presence of bHLH-O2. Arrowheads in (C) and (D) indicate locations of retarded bands.

To determine whether Dpn or E(spl) proteins could also bind to other two putative binding sites, we used non-labeled 20bp DNA fragments containing either bHLH-O1 or bHLH-O2 (Figure 3B) to compete with Cy5-bHLH-O3 for the binding. We observed that the probe containing bHLH-O1 could fully compete with the Cy5-bHLH-O3 for the binding with Dpn, E(spl)m3, E(spl)m7, or E(spl)mβ (Figure 3D). However, the bHLH-O2 probe could only partially compete with the Cy5-bHLH-O3 for the binding, particularly for E(spl)m3, m7, and mβ (Figure 3D). These data suggest that bHLH-O3 and bHLH-O1 have higher affinity for Dpn and E(spl) proteins than bHLH-O2.

Taken together, the results of the gel mobility shift assays indicate that Dpn and a subset of E(spl) proteins can directly bind to the cis-regulatory region of the erm gene. However, not all E(spl) proteins share the same core DNA binding sequences as previously suggested (Jennings et al., 1999).

bHLH-O binding sites mediate the suppression of erm in type II NBs by Dpn/E(spl) proteins

Having demonstrated that the putative binding sites can bind to Dpn and E(spl) proteins in vitro, we next wanted to determine whether these binding sites, particularly bHLH-O1 and bHLH-O3, could indeed mediate the suppression of erm by Dpn or E(spl) proteins in vivo. To this end, we examined whether the deletion of any of these putative bindings sites would lead to ectopic erm expression in type II NBs. We first utilized the existing R9D10-lexA line to examine how deleting bHLH-O1 would affect erm expression. R9D10 is a 3.6kb DNA fragment from the erm regulatory region containing bHLH-O2 and bHLH-O3 but not bHLH-O1 (Figure 4A) (Pfeiffer et al., 2008). We observed that, similar to R9D11-tdTom, lexAop-rCD2-GFP driven by R9D10-LexA is only expressed in INPs but not in type II NBs (Figure 4B–C, I), indicating that deleting bHLH-O1 is not sufficient to induce the ectopic activation of erm in type II NBs and that bHLH-O3 and/or bHLH-O2 might function redundantly with bHLH-O1. Therefore, we further deleted bHLH-O3 by generating a series of 3’ deletions of the overlapping sequence between R9D11 and R9D10 or specifically deleting 12bp sequences containing the C-site (Figure 4A). The truncated or deletion mutant sequences were fused with the reporter gene CD4-tdTom to examine their expression in type II NBs.

Our results showed that the expression of CD4-tdTom remained suppressed in over 80% of type II NBs when it was driven by the entire overlapping sequence (B) between R9D11 and R9D10 or the overlapping sequence with the deletion of a 350bp fragment at the 3’-end (R1) (Figure 4D–E, I). However, deletion of an additional 384bp sequence (R2), including the bHLH-O3, led to ectopic expression of CD4-tdTom in all type II NBs (Figure 4F, I). Consistently, deletion of all three putative binding sites from R9D11 (R9D11-ΔbHLH-O123) led to similar ectopic activation of the reporter in all type II NBs (Figure 4H–I). In contrast, deletion of the bHLH-O3 alone from R9D11 (R9D11-ΔbHLH-O3) did not cause ectopic expression of the reporter in type II NBs (Figure 4G, I). These results demonstrate that bHLH-O1 and bHLH-O3 might function redundantly to mediate the suppression of erm by Dpn or E(spl) proteins. In support of this notion, we showed that the expression of R1 and R9D11-ΔbHLH-O3 in imINPs could still be dramatically suppressed when Dpn was overexpressed in type II NB lineages (Supplementary Figure S2). However, bHLH-O2 may not be critical for the suppression of erm in type II NBs, consistent with its relative low binding affinity for Dpn and E(spl) proteins.

Ectopic activation of dpn or Notch signaling inhibits erm activation in imINPs

In normal type II NB lineages, Erm is only expressed in imINPs, where dpn and Notch signaling are not activated (Janssens et al., 2014). Our previous studies, among others, have shown that Dpn overexpression or Notch overactivation leads to tumorigenic overproliferation of type II NBs due to the dedifferentiation of imINP (Bowman et al., 2008; Zacharioudaki et al., 2012; Zhu et al., 2012). Our findings that Dpn and Notch signaling suppress erm activation in type II NBs prompted us to examine whether the absence of Dpn or Notch signaling is essential for the activation of erm and whether the overexpression of Dpn or overactivation of Notch signaling suppresses Erm expression in imINPs, which in turn contributes to the dedifferentiation of imINPs and subsequent overproliferation of type II NBs. Thus, we next examined how the ectopic activation of dpn or Notch signaling in imINPs would affect Erm expression. In addition, we examined whether misexpression of different E(spl) proteins with distinct binding affinities for the bHLH-O binding sites would affect erm expression in imINPs differently. We used pntP1-GAL4, which is highly expressed in imINPs in addition to type II NBs (Zhu et al., 2011), as a driver for manipulating the expression of these genes in imINPs.

The results showed that the overexpression of Dpn in type II NB lineages resulted in massive overproliferation of type II NBs and imINPs, but a majority of imINPs did not express the erm reporter R9D11-tdTom (Figure 5B), which is typically expressed in imINPs except newly generated imINPs next to the NB in wild-type larval brains (Figure 5A). Similar results were also observed when Nintra or E(spl) proteins, such as E(spl)mβ and E(spl)mδ, which can bind to bHLH-O binding sites, were overexpressed or Numb was knocked down (Figure 5C–F). However, the overexpression of E(spl)m8 or m5, which do not bind to the identified bHLH-O binding sites, did not affect either type II NB lineage development or R9D11-tdTom expression (Figure 5G–H). These results suggest that Dpn overexpression or Notch overactivation suppress the expression of erm in imINPs, but only the E(spl) proteins that bind to the bHLH-O binding sites could function downstream of Notch to suppress erm. Therefore, the absence of Dpn or Notch signaling in imINPs is essential for the activation of erm in imINPs.

Figure 5. Manipulating the expression of Dpn or components of the Notch signaling pathway differentially affects Erm expression and type II NB lineage development.

Figure 5

Open in a new tab

Type II NB lineages are labeled with mCD8-GFP driven by pntP1-GAL4. Arrows: type II NBs; arrowheads: imINPs. (A) R9D11-tdTom is expressed in imINPs but not the NBs in wild-type type II NB lineages. (B–F) Overexpression of Dpn (B), Nintra (C), E(spl)mβ (E), or E(spl)mδ (F), or knockdown of Numb (D) leads to overproliferation of imINPs and type II NBs and suppression of R9D11-tdTom in most imINPs. (G–H) Overexpression of E(spl)m5 (G) or E(spl)m8 (H) neither causes overproliferation of type II NBs nor suppresses the expression of R9D11-tdTom in imINPs.

Erm suppression largely accounts for the dedifferentiation of imINPs resulting from ectopic activation of dpn or Notch signaling in imINPs

The activation of erm in imINPs is required for the maturation of INPs. In the absence of Erm, INPs fail to mature and dedifferentiate into type II NBs (Weng et al., 2010). Therefore, the suppression of erm in imINPs likely contributes to the overproliferation of type II NBs resulting from Notch or Dpn ectopic activation in imINPs. However, in addition to functioning through the canonical pathway to activate the expression of E(spl) genes, Notch could act through noncanonical pathways. Similarly, Dpn may also regulate the expression of other target genes in NBs/INPs, as Dpn is also required for maintaining the self-renewal of type I NBs, in which Erm is not expressed (Janssens et al., 2014; Zhu et al., 2011). Therefore, we examined whether the suppression of erm in imINPs was fully responsible for the overproliferation of type II NBs resulting from the ectopic activation of Dpn or Notch signaling.

To answer this question, we examined how maintaining Erm expression in imINPs would affect the type II NB overproliferation resulting from ectopic activation of Dpn, Notch, or E(spl) proteins. To maintain Erm expression in imINPs, we used erm-GAL4 (II) (Xiao et al., 2012) to drive the expression of UAS-erm while we used the same GAL4 to drive the expression of Dpn, Nintra, E(spl)mβ, or mδ, or knock down Numb in imINPs. Ectopic expression of Dpn, Nintra, E(spl)mβ, or E(spl)mδ, or knockdown of Numb in imINPs all increased the numbers of type II NBs (Figure 6A, C, E, G, I, K, M). However, when erm-GAL4 (II) was used to drive the expression of Erm, the overproliferation phenotype caused by E(spl)mβ or mδ misexpression was completely suppressed, resulting in only 8 type II NBs/brain lobe (Figure 6B, H, J, M). Similarly, the overproliferation phenotype resulting from Dpn misexpression was also suppressed by over 98% (Figure 6L–M). These results indicate that the suppression of Erm is largely responsible for the overproliferation of type II NBs resulting from the ectopic activation of the canonical Notch pathway or Dpn misexpression. However, the overproliferation of type II NBs resulting from misexpression of Nintra or Numb knockdown was only suppressed by 80% or 50% (Figure 6D, F, M), respectively, although their phenotypes were comparable to those caused by the misexpression of Dpn or E(spl) proteins (Figure 6C, E, G, I, K, M), suggesting that Notch also likely acts through a non-canonical pathway to promote the overproliferation of type II NBs.

Figure 6. Maintaining Erm expression in imINPs largely suppresses the overproliferation of type II NBs induced by Dpn overexpression or Notch overactivation.

Figure 6

Open in a new tab

Type II NB linages are labeled with mCD8-GFP driven by erm-GAL4 (II) and arrows point to type II NBs. (A) A wild type brain lobe has only 8 type II NBs. (B) Overexpression of Erm in imINPs does not affect type II NB lineage development. (C, E, G, I, K) Overexpression of Nintra (C), E(spl)mβ (G), E(spl)mδ (I), Dpn (K), or knockdown of Numb (E) in imINPs leads to overproliferation of type II NBs. (D, F, H, J, L) Expression of Erm driven by erm-GAL4 (II) completely or near completely inhibits the generation of extra type II NBs resulting from the overexpression of E(spl)mβ (H), E(spl)mδ (J), or Dpn (L), but only partially suppresses the type II NB overproliferation induced by Nintra overexpression (D) or Numb knockdown (F). (M) Quantifications of the number of type II NBs in brains with indicated genotypes. ***, P < 0.01; NS: not significant.

PntP1 mediates the dedifferentiation of imINPs resulting from the loss of Erm or misexpression of Dpn or E(spl) proteins

Why does the suppression of Erm in imINPs lead to the dedifferentiation of imINPs and subsequent overproliferation of type II NBs? Recently studies have shown that Erm could inhibit the expression of PntP1 and antagonize the function of PntP1 (Janssens et al., 2017; Li et al., 2016). Therefore, we wondered whether Erm promotes INP maturation by similarly inhibiting the expression and/or function of PntP1 in imINPs, in which both PntP1 and Erm are expressed (Janssens et al., 2014; Zhu et al., 2011), and whether the de-repression of PntP1’s expression and/or function in imINPs contribute to the dedifferentiation of imINPs resulting from the loss of Erm and misexpression of Dpn or E(spl) proteins. To test this idea, we then tried to knockdown PntP1 while simultaneously knocking down Erm or ectopically expressed Dpn or E(spl)mδ in imINPs. Consistent with a previous report (Koe et al., 2014), knocking down Erm in imINPs using erm-GAL4 (II) led to an increase in the number of type II NBs from 8/brain lobe to approximately 18/brain lobe (Figure 7A, D, M). However, when Erm and PntP1 were simultaneously knocked down in imINP, only approximately 9 type II NBs per brain lobe were observed (Figure 7B–C, E–F, M), suggesting that the overproliferation of type II NBs resulting from Erm knockdown was largely suppressed by Pnt knockdown. Similarly, the overproliferation of type II NBs resulting from the misexpression of Dpn or E(spl)mδ was also reduced by 90% or 65%, respectively, when PntP1 was simultaneously knocked down in imINPs (Figure 7G–M). These results provide evidence to support that the dedifferentiation of imINPs resulting from the loss of Erm or the misexpression of Dpn or E(spl) proteins is in part due to de-repression of PntP1 expression and/or function in imINPs.

Figure 7. Knocking down PntP1 greatly inhibits the dedifferentiation of imINPs resulting from Erm knockdown or overexpression of Dpn or E(spl)mδ.

Figure 7

Open in a new tab

Type II NB lineages are labeled with mCD8-GFP driven by erm-GAL4 (II). Arrows point to type II NBs. UAS-rCD2 RNAi serves as a control UAS- RNAi. (A) A wild-type brain lobe has only 8 type II NB lineages. (B) Expressing UAS-rCD2 RNAi does not affect type II NB lineage development. (C) Knocking down PntP1 in imINPs by erm-GAL4 (II) slightly increases the number of type II NBs. (D, G, J) Knocking down Erm (D) or overexpressing Dpn (G) or E(spl)mδ (J) in imINPs induces overproliferation of type II NBs. (E, H, K) Knockdown of rCD2 does not affect type II NB overproliferation resulting from Erm knockdown (E) or overexpression of Dpn (H) or E(spl)mδ (K). (F, I, L) Knockdown of PntP1 suppresses the type II NB overproliferation resulting from Erm knockdown (F) or overexpression of Dpn (I) or E(spl)mδ (L). (M) Quantifications of the number of type II NBs in brains with indicated genotypes. ***, P < 0.01.

DISCUSSION

In the present study, we demonstrate that similar to the canonical Notch signaling, Dpn maintains the identity and self-renewal of type II NBs at least in part by inhibiting Erm expression. We show that the loss of Dpn leads to the ectopic activation of erm in type II NBs and that removing Erm not only prevents the transformation of dpn mutant or Dpn knockdown type II NBs into type I-like NBs but also largely inhibits their premature termination of self-renewal. The results from our gel-shift assays and reporter assays provide evidence to support that Dpn and E(spl) proteins suppress Erm expression by directly binding to at least two of the three putative bHLH-O binding sites in the erm enhancer.

Although Dpn and canonical Notch signaling could function through a similar mechanism, these factors do not appear to be completely functionally redundant as previously suggested (Zacharioudaki et al., 2012). First, during early 1st instar larval stages when type II NBs are still quiescent, the maintenance of type II NBs may mainly rely on Dpn in that Notch is not activated in quiescent type II NBs (Zacharioudaki et al., 2012), as evidenced through our findings showing that the loss of Dpn at early 1st instar larval stages leads to ectopic Erm-mediated transformation and the premature loss of type II NBs. Second, after reactivation of type II NBs, both Dpn and Notch signaling are required to suppress the ectopic Erm expression in type II NBs because both the loss of Dpn and the components of the canonical Notch signaling pathways alone (Li et al., 2016) lead to ectopic Erm expression in type II NBs. However, the Notch signaling likely plays a dominant role in suppressing ectopic Erm expression and maintaining type II NBs. We have previously shown that the loss of components of the canonical Notch pathway, including E(spl) proteins, leads to ectopic Erm expression and the transformation and premature loss of type II NBs, despite the presence of Dpn in the NBs, whereas the knockdown of Dpn after the reactivation of NBs only results in the weak ectopic activation of erm but not transformation or premature loss of type II NBs (Li et al., 2016; Zhu et al., 2012). Therefore, Dpn and Notch signaling may not be completely functionally redundant in suppressing the ectopic Erm expression or maintaining type II NBs, and their functions might be dependent on developmental stages. Furthermore, a recent study reported that Klu could also bind to the R9D11 enhancer to repress the expression of Erm (Janssens et al., 2017). Thus, type II NBs likely utilize multiple mechanisms to ensure that erm will not be prematurely activated.

Previous studies suggested that all E(spl) proteins share similar DNA sequences (Jennings et al., 1999). However, results from the present study suggest that this similarity may not always be the case. Our gel-shift assays show that only 5 members of the E(spl) family, including E(spl)mγ, mβ, mδ, m3, and m7, can bind to the bHLH-O binding sites in the erm regulatory region, whereas the other two, E(spl)m5 and m8, cannot. The difference in their DNA binding specificity is consistent with differences in the amino acid sequences of their bHLH domains and their overexpression phenotypes in type II NB lineages (Zacharioudaki et al., 2012). Therefore, although multiple E(spl) proteins have been shown to be expressed in larval NBs and at least two of them, E(spl)mγ and m8, are activated by Notch (Zacharioudaki et al., 2012), these E(spl) proteins may bind to different DNA sequences and regulate the expression of different target genes, which may in turn determine their functional specificity.

In contrast to the maintenance of type II NBs, the maturation of imINPs requires the activation of erm by PntP1 and shutdown of Dpn expression and Notch signaling. It has previously been shown that the loss of Erm or aberrant activation of dpn or Notch signaling in imINPs both lead to the dedifferentiation of imINPs and overproliferation of type II NBs (Bowman et al., 2008; Weng et al., 2010; Zacharioudaki et al., 2012; Zhu et al., 2012). However, the functional relationship between the activation of erm and the absence of Dpn or Notch signaling in imINPs has never been established. Here, we demonstrate here that the absence of Dpn and Notch signaling is essential for the activation of erm and subsequent Erm-mediated maturation of INPs. First, the results show that aberrant activation of dpn or Notch signaling inhibits the activation of erm in imINPs. Second, maintaining Erm expression in imINPs largely blocks the overproliferation of type II NBs resulting from the misexpression of E(spl) or Dpn proteins, suggesting that one main reason for the dedifferentiation of imINPs caused by Dpn or E(spl) overexpression is the suppression of Erm. However, the overproliferation of type II NBs resulting from the overexpression of Nintra or Numb knockdown can only be partially suppressed by concomitant Erm expression. Therefore, in addition to functioning through the canonical pathway to activate E(spl) expression, Notch may also act through noncanonical pathways, such as the mTORC2/Akt pathway (Lee et al., 2013), to regulate type II NB proliferation.

How does Erm promotes INP maturation and prevents the dedifferentiation of imINP? It has previously been suggested that Erm prevents the dedifferentiation of INPs by activating pros expression and attenuating the response of INPs to self-renewing factors such as Dpn and E(spl) proteins (Janssens et al., 2014; Weng et al., 2010). However, two pieces of evidence argue against this notion. First, the loss of Pros only induces the overproliferation of INPs but not the dedifferentiation of imINPs into type II NBs (Bowman et al., 2008). Second, Erm is only expressed in imINPs, which do not express Dpn or E(spl) proteins (Boone and Doe, 2008; Janssens et al., 2014; Song and Lu, 2011). In the present study, we provide evidence demonstrating that Erm likely promotes INP maturation in part by inhibiting the expression and/or function of PntP1. These results show that the overproliferation of type II NBs resulting from the loss of Erm or overexpression of Dpn or E(spl) proteins, which leads to suppression of Erm expression, could be significantly inhibited by knocking down PntP1. These data strongly argue that the dedifferentiation of imINPs and generation of extra type II NBs resulting from the loss of Erm is in part due to de-repression of PntP1 expression and/or function in imINPs, which is consistent with the PntP1 function in specifying type II NBs and suppressing the activation of ase (Zhu et al., 2011). Similar to other Ets family proteins that are commonly involved in tumorigenesis (Kar and Gutierrez-Hartmann, 2013; Seth and Watson, 2005), PntP1 may also activate the expression of cell cycle regulators that promote nonproliferative imINPs to enter the cell cycle and initiate unrestricted tumorigenic overproliferation. However, PntP1 may not be the only target of Erm in imINPs. As shown in a recent study, in addition to PntP1, Erm also directly inhibits the expression of Grh-O in imINPs (Janssens et al., 2017). Therefore, Erm likely promotes the maturation of INPs by regulating the expression/function of multiple target genes.

In conclusion, we demonstrate here that similar to Notch signaling, Dpn maintains the identity and self-renewal of type II NBs in part by inhibiting Erm expression. Whereas in imINPs, the absence of Dpn and E(spl) proteins allows PntP1-mediated activation of erm, which in turn promotes INP maturation by inhibiting the expression and/or function of PntP1 and Grh-O in imINPs. Thus, the present study elucidates the mechanistic details of the maintenance of type II NBs and maturation of INPs.

Supplementary Material

supplement

Highlights.

  • Deadpan maintains Drosophila type II neuroblasts by suppressing Earmuff (Erm)

  • bHLH-O proteins bind directly to the erm promoter

  • Absence of bHLH-O proteins in imINPs allows erm activation and INP maturation

  • Erm promotes INP maturation by antagonizing the function of Pointed P1

Acknowledgments

We thank Drs. YN Jan, C. Desplan, C-Y Lee, C Han, and T Lee for antibodies and fly lines; the Bloomington Drosophila Stock Center and the Transgenic RNAi Resources Project for fly stocks; X Deng and Y Xie for technical support; Zhu lab members for thoughtful discussion and comments; Rainbow Transgenic Flies, Inc. for generating transgenic flies.

Funding: This work was supported by the National Institute of Neurological Disorders and Stroke of the National Institutes of Health under Award Number R01NS085232 (S.Z.).

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Author contributions

X.L. and S.Z. conceived the idea, analyzed the data, and wrote the manuscript. X.L. and R.C. carried out the experiments and collected the data.

Competing financial interests

The authors declare no competing financial interests.

References

  1. Barbash DA, Cline TW. Genetic and molecular analysis of the autosomal component of the primary sex determination signal of Drosophila melanogaster. Genetics. 1995;141:1451–1471. doi: 10.1093/genetics/141.4.1451. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Bello BC, Izergina N, Caussinus E, Reichert H. Amplification of neural stem cell proliferation by intermediate progenitor cells in Drosophila brain development. Neural Dev. 2008;3:5. doi: 10.1186/1749-8104-3-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Betschinger J, Mechtler K, Knoblich JA. Asymmetric segregation of the tumor suppressor brat regulates self-renewal in Drosophila neural stem cells. Cell. 2006;124:1241–1253. doi: 10.1016/j.cell.2006.01.038. [DOI] [PubMed] [Google Scholar]
  4. Bier E, Vaessin H, Younger-Shepherd S, Jan LY, Jan YN. deadpan, an essential pan-neural gene in Drosophila, encodes a helix-loop-helix protein similar to the hairy gene product. Genes Dev. 1992;6:2137–2151. doi: 10.1101/gad.6.11.2137. [DOI] [PubMed] [Google Scholar]
  5. Boone JQ, Doe CQ. Identification of Drosophila type II neuroblast lineages containing transit amplifying ganglion mother cells. Dev Neurobiol. 2008;68:1185–1195. doi: 10.1002/dneu.20648. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Bowman SK, Rolland V, Betschinger J, Kinsey KA, Emery G, Knoblich JA. The tumor suppressors Brat and Numb regulate transit-amplifying neuroblast lineages in Drosophila. Dev Cell. 2008;14:535–546. doi: 10.1016/j.devcel.2008.03.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Brand M, Jarman AP, Jan LY, Jan YN. asense is a Drosophila neural precursor gene and is capable of initiating sense organ formation. Development. 1993;119:1–17. doi: 10.1242/dev.119.Supplement.1. [DOI] [PubMed] [Google Scholar]
  8. Davis RL, Turner DL. Vertebrate hairy and Enhancer of split related proteins: transcriptional repressors regulating cellular differentiation and embryonic patterning. Oncogene. 2001;20:8342–8357. doi: 10.1038/sj.onc.1205094. [DOI] [PubMed] [Google Scholar]
  9. Fisher AL, Caudy M. Groucho proteins: transcriptional corepressors for specific subsets of DNA-binding transcription factors in vertebrates and invertebrates. Genes Dev. 1998;12:1931–1940. doi: 10.1101/gad.12.13.1931. [DOI] [PubMed] [Google Scholar]
  10. Han C, Jan LY, Jan YN. Enhancer-driven membrane markers for analysis of nonautonomous mechanisms reveal neuron-glia interactions in Drosophila. Proc Natl Acad Sci U S A. 2011;108:9673–9678. doi: 10.1073/pnas.1106386108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Hatakeyama J, Bessho Y, Katoh K, Ookawara S, Fujioka M, Guillemot F, Kageyama R. Hes genes regulate size, shape and histogenesis of the nervous system by control of the timing of neural stem cell differentiation. Development. 2004;131:5539–5550. doi: 10.1242/dev.01436. [DOI] [PubMed] [Google Scholar]
  12. Imayoshi I, Kageyama R. bHLH factors in self-renewal, multipotency, and fate choice of neural progenitor cells. Neuron. 2014;82:9–23. doi: 10.1016/j.neuron.2014.03.018. [DOI] [PubMed] [Google Scholar]
  13. Ishibashi M, Ang SL, Shiota K, Nakanishi S, Kageyama R, Guillemot F. Targeted disruption of mammalian hairy and Enhancer of split homolog-1 (HES-1) leads to up-regulation of neural helix-loop-helix factors, premature neurogenesis, and severe neural tube defects. Genes Dev. 1995;9:3136–3148. doi: 10.1101/gad.9.24.3136. [DOI] [PubMed] [Google Scholar]
  14. Janssens DH, Hamm DC, Anhezini L, Xiao Q, Siller KH, Siegrist SE, Harrison MM, Lee CY. An Hdac1/Rpd3-Poised Circuit Balances Continual Self-Renewal and Rapid Restriction of Developmental Potential during Asymmetric Stem Cell Division. Dev Cell. 2017;40:367–380. e367. doi: 10.1016/j.devcel.2017.01.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Janssens DH, Komori H, Grbac D, Chen K, Koe CT, Wang H, Lee CY. Earmuff restricts progenitor cell potential by attenuating the competence to respond to self-renewal factors. Development. 2014;141:1036–1046. doi: 10.1242/dev.106534. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Jennings BH, Tyler DM, Bray SJ. Target specificities of Drosophila enhancer of split basic helix-loop-helix proteins. Mol Cell Biol. 1999;19:4600–4610. doi: 10.1128/mcb.19.7.4600. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Kageyama R, Ohtsuka T, Kobayashi T. The Hes gene family: repressors and oscillators that orchestrate embryogenesis. Development. 2007;134:1243–1251. doi: 10.1242/dev.000786. [DOI] [PubMed] [Google Scholar]
  18. Kar A, Gutierrez-Hartmann A. Molecular mechanisms of ETS transcription factor-mediated tumorigenesis. Crit Rev Biochem Mol Biol. 2013;48:522–543. doi: 10.3109/10409238.2013.838202. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Koe CT, Li S, Rossi F, Wong JJ, Wang Y, Zhang Z, Chen K, Aw SS, Richardson HE, Robson P, Sung WK, Yu F, Gonzalez C, Wang H. The Brm-HDAC3-Erm repressor complex suppresses dedifferentiation in Drosophila type II neuroblast lineages. eLife. 2014;3:e01906. doi: 10.7554/eLife.01906. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Lee KS, Wu Z, Song Y, Mitra SS, Feroze AH, Cheshier SH, Lu B. Roles of PINK1, mTORC2, and mitochondria in preserving brain tumor-forming stem cells in a noncanonical Notch signaling pathway. Genes Dev. 2013;27:2642–2647. doi: 10.1101/gad.225169.113. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Lee T, Luo L. Mosaic analysis with a repressible cell marker for studies of gene function in neuronal morphogenesis. Neuron. 1999;22:451–461. doi: 10.1016/s0896-6273(00)80701-1. [DOI] [PubMed] [Google Scholar]
  22. Li X, Xie Y, Zhu S. Notch maintains Drosophila type II neuroblasts by suppressing the expression of the Fez transcription factor Earmuff. Development. 2016 doi: 10.1242/dev.136184. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. McGuire SE, Le PT, Osborn AJ, Matsumoto K, Davis RL. Spatiotemporal rescue of memory dysfunction in Drosophila. Science. 2003;302:1765–1768. doi: 10.1126/science.1089035. [DOI] [PubMed] [Google Scholar]
  24. Neumuller RA, Knoblich JA. Dividing cellular asymmetry: asymmetric cell division and its implications for stem cells and cancer. Genes Dev. 2009;23:2675–2699. doi: 10.1101/gad.1850809. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Oellers N, Dehio M, Knust E. bHLH proteins encoded by the Enhancer of split complex of Drosophila negatively interfere with transcriptional activation mediated by proneural genes. Mol Gen Genet. 1994;244:465–473. doi: 10.1007/BF00583897. [DOI] [PubMed] [Google Scholar]
  26. Ohtsuka T, Ishibashi M, Gradwohl G, Nakanishi S, Guillemot F, Kageyama R. Hes1 and Hes5 as notch effectors in mammalian neuronal differentiation. EMBO J. 1999;18:2196–2207. doi: 10.1093/emboj/18.8.2196. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Paridaen JT, Huttner WB. Neurogenesis during development of the vertebrate central nervous system. EMBO Rep. 2014;15:351–364. doi: 10.1002/embr.201438447. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Paroush Z, Finley RL, Jr, Kidd T, Wainwright SM, Ingham PW, Brent R, Ish-Horowicz D. Groucho is required for Drosophila neurogenesis, segmentation, and sex determination and interacts directly with hairy-related bHLH proteins. Cell. 1994;79:805–815. doi: 10.1016/0092-8674(94)90070-1. [DOI] [PubMed] [Google Scholar]
  29. Pfeiffer BD, Jenett A, Hammonds AS, Ngo TT, Misra S, Murphy C, Scully A, Carlson JW, Wan KH, Laverty TR, Mungall C, Svirskas R, Kadonaga JT, Doe CQ, Eisen MB, Celniker SE, Rubin GM. Tools for neuroanatomy and neurogenetics in Drosophila. Proc Natl Acad Sci U S A. 2008;105:9715–9720. doi: 10.1073/pnas.0803697105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Pfeiffer BD, Ngo TT, Hibbard KL, Murphy C, Jenett A, Truman JW, Rubin GM. Refinement of tools for targeted gene expression in Drosophila. Genetics. 2010;186:735–755. doi: 10.1534/genetics.110.119917. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. San-Juan BP, Baonza A. The bHLH factor deadpan is a direct target of Notch signaling and regulates neuroblast self-renewal in Drosophila. Dev Biol. 2011;352:70–82. doi: 10.1016/j.ydbio.2011.01.019. [DOI] [PubMed] [Google Scholar]
  32. Seth A, Watson DK. ETS transcription factors and their emerging roles in human cancer. Eur J Cancer. 2005;41:2462–2478. doi: 10.1016/j.ejca.2005.08.013. [DOI] [PubMed] [Google Scholar]
  33. Song Y, Lu B. Regulation of cell growth by Notch signaling and its differential requirement in normal vs. tumor-forming stem cells in Drosophila. Genes Dev. 2011;25:2644–2658. doi: 10.1101/gad.171959.111. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Wallace K, Liu TH, Vaessin H. The pan-neural bHLH proteins DEADPAN and ASENSE regulate mitotic activity and cdk inhibitor dacapo expression in the Drosophila larval optic lobes. Genesis. 2000;26:77–85. doi: 10.1002/(sici)1526-968x(200001)26:1<77::aid-gene10>3.0.co;2-r. [DOI] [PubMed] [Google Scholar]
  35. Weng M, Golden KL, Lee CY. dFezf/Earmuff maintains the restricted developmental potential of intermediate neural progenitors in Drosophila. Dev Cell. 2010;18:126–135. doi: 10.1016/j.devcel.2009.12.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Winston RL, Millar DP, Gottesfeld JM, Kent SB. Characterization of the DNA binding properties of the bHLH domain of Deadpan to single and tandem sites. Biochemistry. 1999;38:5138–5146. doi: 10.1021/bi982856a. [DOI] [PubMed] [Google Scholar]
  37. Xiao Q, Komori H, Lee CY. klumpfuss distinguishes stem cells from progenitor cells during asymmetric neuroblast division. Development. 2012;139:2670–2680. doi: 10.1242/dev.081687. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Xie Y, Li X, Deng X, Hou Y, O'Hara K, Urso A, Peng Y, Chen L, Zhu S. The Ets protein Pointed prevents both premature differentiation and dedifferentiation of Drosophila intermediate neural progenitors. Development. 2016;143:3109–3118. doi: 10.1242/dev.137281. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Younger-Shepherd S, Vaessin H, Bier E, Jan LY, Jan YN. deadpan, an essential pan-neural gene encoding an HLH protein, acts as a denominator in Drosophila sex determination. Cell. 1992;70:911–922. doi: 10.1016/0092-8674(92)90242-5. [DOI] [PubMed] [Google Scholar]
  40. Yu HH, Chen CH, Shi L, Huang Y, Lee T. Twin-spot MARCM to reveal the developmental origin and identity of neurons. Nat Neurosci. 2009;12:947–953. doi: 10.1038/nn.2345. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Zacharioudaki E, Magadi SS, Delidakis C. bHLH-O proteins are crucial for Drosophila neuroblast self-renewal and mediate Notch-induced overproliferation. Development. 2012;139:1258–1269. doi: 10.1242/dev.071779. [DOI] [PubMed] [Google Scholar]
  42. Zhu S, Barshow S, Wildonger J, Jan LY, Jan YN. Ets transcription factor Pointed promotes the generation of intermediate neural progenitors in Drosophila larval brains. Proc Natl Acad Sci U S A. 2011;108:20615–20620. doi: 10.1073/pnas.1118595109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Zhu S, Wildonger J, Barshow S, Younger S, Huang Y, Lee T. The bHLH repressor Deadpan regulates the self-renewal and specification of Drosophila larval neural stem cells independently of Notch. PLoS One. 2012;7:e46724. doi: 10.1371/journal.pone.0046724. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

supplement
NIHMS906418-supplement.docx (1.7MB, docx)

RESOURCES