Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2018 Nov 15.
Published in final edited form as: Dev Biol. 2017 Sep 21;431(2):168–178. doi: 10.1016/j.ydbio.2017.09.026

Neural crest cells utilize primary cilia to regulate ventral forebrain morphogenesis via Hedgehog-dependent regulation of oriented cell division

Elizabeth N Schock 1,2, Samantha A Brugmann 1,2,*
PMCID: PMC5658255  NIHMSID: NIHMS910725  PMID: 28941984

Abstract

Development of the brain directly influences the development of the face via both physical growth and Sonic hedgehog (SHH) activity; however, little is known about how neural crest cells (NCCs), the mesenchymal population that comprises to the developing facial prominences, influence the development of the brain. We utilized the conditional ciliary mutant, Wnt1-Cre;Kif3afl/fl, to demonstrate that loss of primary cilia on NCCs resulted in a widened ventral forebrain. We found that neuroectodermal Shh expression, dorsal/ventral patterning, and amount of proliferation in the ventral neuroectoderm was not changed in Wnt1-Cre;Kif3afl/fl mutants; however, tissue polarity and directional cell division were disrupted. Furthermore, NCCs of Wnt1-Cre;Kif3afl/fl mutants failed to respond to a SHH signal emanating from the ventral forebrain. We were able to recapitulate the ventral forebrain phenotype by removing Smoothened from NCCs (Wnt1-Cre;Smofl/fl) indicating that changes in the ventral forebrain were mediated through a Hedgehog-dependent mechanism. Together, these data suggest a novel, cilia-dependent mechanism for NCCs during forebrain development.

Keywords: neural crest, primary cilia, Wnt1-cre, Sox10-Cre, ventral forebrain, Hedgehog signaling

Introduction

Neural crest cells (NCCs) are a pluripotent, migratory population of cells that contribute significantly to the development of the craniofacial complex (Bronner and LeDouarin, 2012; Buitrago-Delgado et al., 2015; Le Douarin et al., 2004). During early craniofacial development, cranial NCCs lie adjacent to cell types from all three germ layers and multiple established developmental signaling centers, such as the frontonasal ectodermal zone (FEZ) and ventral neuroectoderm. Several studies have demonstrated that NCCs are finely tuned to receive instructive signals from adjacent tissues, especially ectodermal signaling centers. NCCs directly underlie the dental placode, which expresses Sonic hedgehog (Shh), and condense around the placode in response to this epithelial signal (Hardcastle et al., 1998). A similar pattern of molecular or cellular response is observed in NCCs underlying epithelial Shh in the oral ectoderm overlaying the tongue anlage, the rugae of the developing palate, and the FEZ that defines the midface (Hu et al., 2003; Rice et al., 2006; Torii et al., 2016). Taken together, these data assert that during early craniofacial development, NCCs are highly responsive to cues emanating from signaling centers.

In addition to signaling centers within the facial and oral ectoderm, NCCs are also influenced by neuroectodermal signaling centers. The ventral forebrain serves as a SHH signaling center that can directly influence the behavior of NCC with in the facial midline (Chong et al., 2012; Hu et al., 2015; Marcucio et al., 2005). Increasing SHH in the ventral forebrain results in mid-facial widening, while abrogating a SHH signal produced a narrowed or collapsed mid-face, decreased proliferation of NCCs, and subsequently reduced the size of the facial prominences (Aoto and Trainor, 2015; Hu and Marcucio, 2009; Marcucio et al., 2005). Several human conditions support a hypothesis that development of the brain and face are tightly coupled. A classic example of this is holoprosencephaly (HPE), which is most commonly caused by mutations in the SHH pathway, where individuals present with a spectrum of correlative brain and craniofacial malformation. In more severe cases of HPE, individuals present with an alobar prosencephalon and severe midfacial defects including cyclopia, clefting, and presence of a proboscis (Roessler et al., 1996). Conversely, less severe manifestation of HPE typically feature microcephaly, mild hypotelorism, and a single central incisor (Roessler et al., 1996). While the growth of the brain physically influences facial morphogenesis, it is more likely that dysmorphology in HPE is a consequence of failed signal transduction between the forebrain, NCCs, and facial ectoderm (Diewert and Lozanoff, 1993; Petryk et al., 2015). Similar to HPE, midline facial defects with hypertelorism, such as frontonasal dysplasia, are frequently associated with multiple congenital anomalies. Dysmorphological examination of patients with these disorders suggested that structural central nervous system anomalies and midfacial defects seem to have an intrinsic embryological relationship (Gil-da-Silva Lopes and Giffoni, 2006; DeMyer, 1975). Together, studies such as these imply a strong connection between the development of the face and the brain.

Despite a sizable amount of data suggesting NCCs are the recipient of instructive signals during early craniofacial development, there is also evidence that NCCs play an instructive role in influencing the development of adjacent tissues, including the developing brain (reviewed in Creuzet, 2009; Le Douarin et al., 2007). Experiments in chick demonstrated that pre-migratory NCCs express BMP antagonists, which are required to establish one of the earliest forebrain signaling centers, the anterior neural ridge (ANR). Similarly, misexpression of Hoxa2 in pre-migratory cranial NCCs reduced Fgf8 expression in the ANR and produced a dysmorphic and hypoplastic prosencephalon. Complete ablation of pre-migratory NCCs resulted in even more severe dorsal forebrain defects in chick embryos (Creuzet et al., 2004; Creuzet et al., 2006; Etchevers et al., 1999; Garcez et al., 2014). β-catenin in NCCs has been shown to regulate the morphogenesis of the interhemispheric region of the dorsal telencephalon, indicating that Wnt signaling in NCCs is important for forebrain development (Choe et al., 2014). Finally, it is hypothesized that NCCs repress SHH signaling from the basal plate (Creuzet et al., 2006).

It has been extensively reported that the Hedgehog pathway is transduced via a microtubule-based organelle called the primary cilium (Eggenschwiler and Anderson, 2007; Rohatgi et al., 2007). Individuals with ciliopathies, diseases caused by defects in the structure and/or function of primary cilia, often present with a combination of craniofacial defects and either physical or cognitive brain impairment (Schock and Brugmann, 2017; Snedeker et al., 2017; Willaredt et al., 2013; Zaghloul and Brugmann, 2011). Our prior work examined the facial phenotypes that arise when NCCs lack primary cilia (Wnt1-Cre;Kif3afl/fl). We previously reported that Wnt1-Cre;Kif3afl/fl mutants possessed multiple craniofacial phenotypes, including: severe midfacial widening, micrognathia, and aglossia (Brugmann et al., 2010; Chang et al., 2016; Chang et al., 2015; Millington et al., 2017). Furthermore, we found that these phenotypes were the result of aberrant Hedgehog signal transduction in NCCs. Herein, we again utilize the Wnt1-Cre;Kif3afl/fl conditional mutant to explore a potential relationship between NCCs of the facial midline and the adjacent developing forebrain. This work ascribes a novel role for NCC-derived, cilia-dependent HH signaling in the regulation of ventral forebrain morphogenesis.

Material and methods

Transgenic Mice

Kif3afl/fl mice were from Dr. Bradley Yoder (University of Alabama at Birmingham). Smofl/fl (Smotm2/Amc/J), ROSAmT/mG, Wnt1-Cre, and Sox10-Cre mice were purchased from Jackson laboratory. All mice were maintained by Veterinary Services of Cincinnati Children’s Hospital Medical Center with IACUC approval.

Genotyping

Embryos e10.5 or younger were genotyped using the following primer sets: Kif3a F: GCTTGTCATCTGGGGAGATT; Kif3a R: GAACTCCTGGAGGCAGAGG (floxed allele: 606 bp; wildtype allele: 476 bp); Cre F: ATGCCCAAGAAGAAGAGGAAGGT; Cre R: GAAATC ACTGCGTTCGAACGCTAGA (product size: 447 bp); Smo WT F: CCACTGCGAGCCT TTGCGCTAC; Smo WT R: CCCATCACCTCCGCGTCGCA: Smo mutant F: CTTGGG TGGAGAGGCTATTC; Smo mutant R: AGGTGAGATGACAGGAGATC (WT allele: 160 bp; mutant allele: 280 bp).

Hematoxylin and Eosin

Sections were deparaffinized, rehydrated, and nuclei were stained with hematoxylin (Vector Laboratories, Inc.). Sections were rinsed in water and then placed briefly in Eosin Y (Sigma-Aldrich). Sections were dehydrated and mounted using Permount (Fisher Scientific).

MicroCT

Wild-type, Wnt1-Cre;Kif3afl/fl, Wnt1-Cre;Smofl/fl, and Sox10-Cre;Kif3afl/fl embryos were harvested at e11.5, fixed overnight in 4% PFA, washed in PBS, and placed in 50% Lugol solution (L6146-1L, Sigma-Aldrich) for 2 days to 1 week. Embryos were scanned using a MicroCAT II v. 1.9d (Imtek) with COBRA v.7.4 (Exxim Computing Corporation) software used for image reconstruction. OsiriX was used for image display and analysis.

In situ hybridization

Patterns of gene expression in wild-type and mutant embryos were analyzed using whole-mount and sectioned in situ hybridization (WISH/SISH) with digoxigenin-labeled riboprobes. The protocol used for WISH was slightly modified from the Gallus gallus expression in situ hybridization analysis site (GEISHA)(Acloque et al., 2008; Streit and Stern, 2001). SISH experiments followed the protocol described in (Brugmann et al., 2010).

Immunostaining

Immunostaining was performed using standard protocols. Briefly, embryos were fixed in 4% PFA overnight and processed for either paraffin or cryo embedding. Sections were cut to 10 µm thickness. Following antigen retrieval, slides were incubated overnight at 4°C with primary antibodies. Secondary antibodies with fluorescent tags were then applied at a dilution of 1:1000 and incubated at room temperature for 1 h. Slides were stained with DAPI (1:10,000) and mounted with mounting medium (ProLong Gold or Prolong Diamond). Antibodies used in this study were as follows: GFP (1:1000, Abcam), RFP (1:50, Rockland Inc.), PAX6 (1:1000, Biolegend), GSX2 (1:2500, gift from Kenny Campbell (Toresson et al., 2000)), NXK2.1 (1:800, Seven Hills Bio Reagents), ARL13B (1:500, Protein Tech), PHH3 (1:500, Millipore), GM130 (1:500, BD Bioscience, gift from Yu Lan), Laminin (1:250, Sigma, gift from Rolf Stottmann), rhodamine conjugated Phalliodin (1:200, Invitrogen), β-catenin (1:200, Abcam, gift from Rolf Stottmann), PAR3 (1:200, Millopore).

Cell counts

Cells counts were conducted using ImageJ software and the Cell Counter plug-in.

Golgi body angle analysis

The cell Golgi body was identified via immunostaining for GM130. The angle that the Golgi body made to the nucleus of each cell relative to the embryonic midline was measured manually using a protractor with increments of 30°. Sections from three different embryos of each genotype were used in the analysis.

Angle of cell division

PHH3 positive cells that were either in anaphase or telophase were identified and the angle of cell division relative to the apical surface of the neuroectoderm was measured using a protractor with 15° increments.

Statistics

Two-tailed student’s t-tests were used to determine significance.

Imaging and image processing

All images were taken using a Leica DFC310 FX camera attached to either a Leica DM5000 B microscope or a Leica M165 C stereoscope. Image brightness and contrast was adjusted using Photoshop.

Results

Wnt1-Cre;Kif3afl/fl mutants have defects in the ventral forebrain

Our previous work utilizing the Wnt1-Cre;Kif3afl/fl conditional ciliary mutant examined the mutant’s craniofacial phenotypes, including: midfacial widening (Fig. 1A, B), a duplicated nasal septum, and aglossia (Brugmann et al., 2010; Chang et al., 2016; Millington et al., 2017). While each of these phenotypes was striking and severe, they were not necessarily surprising, as neural crest cells (NCCs) contribute significantly to the development of each of these structures (Chai et al., 2000; Danielian et al., 1998; Noden and Trainor, 2005). However, we also observed a striking malformation in the brain of Wnt1-Cre;Kif3afl/fl mutants. Specifically, Wnt1-Cre;Kif3afl/fl mutants exhibited a widened ventral forebrain in the region of the third ventricle, relative to wild-type embryos (Fig. 1C, D). The identification of this phenotype was unexpected as there is no known NCC contribution to this area other than a small portion of NCCs that give rise to pericytes (Yamanishi et al., 2012). To further characterize this surprising phenotype, we set out to determine when morphological widening of the ventral forebrain first occurred in Wnt1-Cre;Kif3afl/fl mutants. We used Micro-Computed Tomography (MicroCT) to assess three-dimensional morphology in e11.5 embryos (Fig. 1E, F). Analysis of frontal planes of wild-type e11.5 embryos demonstrated that the width of the ventral forebrain gradually decreased along the caudal to rostral axis (Fig. 1G 1–5; n=8). In contrast, the ventral portion of the forebrain failed to narrow through the diencephalon and pre-optic area in Wnt1-Cre;Kif3afl/fl mutants (Fig. 1G 1’–5’; n=4). We quantified the width of the ventral forebrain at each position and found that the ventral forebrain was statistically wider in Wnt1-Cre;Kif3afl/fl mutants all along the caudal to rostral axis (Fig. 1H). Additionally, we noted that Wnt1-Cre;Kif3afl/fl mutants had a thinned ventral neuroectoderm and that there were fewer NCCs underlying the neuroectoderm in that region (Fig. 1G, arrows; Supp. Fig. 1). We next wanted to understand the how an intrinsic loss of cilia on NCCs could exert an extrinsic effect on this area of the developing brain. We hypothesized that a widened ventral forebrain could be generated by multiple molecular or cellular mechanisms, including Wnt1-Cre meditated neuroectodermal recombination, a gain of Sonic hedgehog (SHH) activity, or increased cell proliferation in the ventral neuroectoderm. To understand the etiology of this phenotype, we explored each hypothesis as a possible cause of ventral forebrain widening in Wnt1-Cre;Kif3afl/fl mutants.

Figure 1. Wnt1-Cre;Kif3afl/fl conditional ciliary mutants have a widened ventral forebrain.

Figure 1

Open in a new tab

Frontal view of whole-mount e13.5 (A) wild-type and (B) Wnt1-Cre;Kif3afl/fl embryos. H&E staining on frontal sections of e13.5 (C) wild-type and (D) Wnt1-Cre;Kif3afl/fl embryos. Wnt1-Cre;Kif3afl/fl mutants had a widened ventral forebrain in the region of the third ventricle (black arrow). Surface renderings of MicroCT scans of (E) wild-type and (F) Wnt1-Cre;Kif3afl/fl mutants. Frontal segmentations (red dotted lines in E, F) from MicroCT scans of e11.5 (G, 1–5) wild-type and (G, 1’–5’) Wnt1-Cre;Kif3afl/fl embryos. While the ventral portion of the forebrain narrowed in more rostral segments in wild-type embryos, the ventral forebrain of Wnt1-Cre;Kif3afl/fl mutants was widened (white dotted lines). (H) Quantification of ventral forebrain widths at multiple axial levels. Optic chiasm (oc), diencephalon (di), telencephalon (tel); P-values: (*) P<0.05, (**) P<0.01, (***) P<0.001; Scale bars: (A, B) 1.3 mm, (C, D) 600 µm, (E, F) 85 au, (G) 80 au.

Wnt1-Cre mediates recombination in the ventral telencephalon

The Wnt1-Cre driver initiates recombination at approximately 3-somite stage in the dorsal third of the neural tube including the NCCs (Jacques-Fricke, 2012; Hari et al., 2012) and has been used extensively within the craniofacial community to conditionally remove gene expression from the NCC lineage (Chai et al., 2000; Danielian et al., 1998). Despite its common use to study NCC development, recombination has been observed in areas outside the NCC (e.g., the dorsal midbrain). Furthermore, recent work has discovered the driver induces ectopic Wnt activity in the midbrain (Lewis et al., 2013). Based on these issues, we wanted to investigate the possibility that morphological changes in the brain were due to loss of cilia within the neuroectoderm caused by Wnt1-Cre-mediated recombination. We closely examined Wnt1-Cre recombination in embryos carrying the ROSAmT/mG dual transgenic reporter (Muzumdar et al., 2007). Lineage tracing confirmed recombination within NCCs and midbrain dorsal neuroectoderm (Fig. 2A). To our surprise, we also observed a previously uncharacterized region of recombination of within the ventral forebrain of e10.5 ROSAmT/mG;Wnt1-Cre embryos (Fig. 2A’, A”). We detected a few cells in the ventral forebrain at e10.0 that faintly expressed GFP (Fig. 2B, B’, B”); however, this region of recombination was not present at e9.5 (Fig. 2C, C’, C”). This finding prompted us to further examine this Wnt1-Cre-mediated ventral neuroectodermal region of recombination.

Figure 2. Wnt1-Cre mediated recombination occurs in both the NCCs and the ventral forebrain.

Figure 2

Open in a new tab

Whole-mount images of ROSAmT/mG;Wnt1-Cre embryos at (A) e10.5 (B), e10.0, (C) and e9.5. Frontal sections of ROSAmT/mG;Wnt1-Cre embryos at (A’, A”) e10.5, (B’, B”) e10.0, and (C’, C”) e9.5. Cre-mediated recombination in the ventral forebrain neuroectoderm was first observed at (B”) e10.0 with more robust recombination by (A”) e10.5. Frontal sections of (D) ROSAmT/mG;Wnt1-Cre;Kif3afl/+ and (G) ROSAmT/mG;Wnt1-Cre;Kif3afl/fl embryos at e10.5. ARL13B immunostaining assaying cilia extension in (E, F) ROSAmT/mG;Wnt1-Cre;Kif3afl/+ and (H, I) ROSAmT/mG;Wnt1-Cre;Kif3afl/fl embryos. Primary cilia extended (white arrows) from (E) recombined NCCs and (F) neuroectodermal cells in ROSAmT/mG;Wnt1-Cre;Kif3afl/+ embryos while ciliary extension was lost in both (H) NCCs and (I) neuroectodermal cells in ROSAmT/mG;Wnt1-Cre;Kif3afl/fl mutants. Neural crest cells (ncc), neuroectoderm (ne); Scale bars: (A) 800 µm, (A’, B’) 200 µm, (A”) 100 µm, (B) 500 µm, (B”) 65 µm, (C) 275 µm, (C’) 150 µm, (C”) 100 µm, (D, G) 200 µm, (E, F, H, I) 5 µm.

To determine if Cre-mediated recombination within the ventral neuroectoderm was sufficient to cause loss of KIF3A-dependent ciliogenesis, we assayed ciliary extension via immunostaining for axonemal marker ARL13B (Caspary et al., 2007). ROSAmT/mG;Wnt1-Cre;Kif3afl/+ embryos extended primary cilia in recombined NCCs and in the recombined ventral neuroectoderm at e10.5 (Fig. 2D–F). As expected, ROSAmT/mG;Wnt1-Cre;Kif3afl/fl mutants failed to extend primary cilia within NCCs (Fig. 2G, H); however, we also a observed loss of ciliary extension within the recombined cells of the ventral forebrain neuroectoderm (Fig. 2I). These data indicated that both NCCs and a portion of cells in the ventral forebrain neuroectoderm lacked primary cilia in Wnt1-Cre;Kif3afl/fl mutants. Based on these data, we hypothesized that the neuroectodermal phenotype in Wnt1-Cre;Kif3afl/fl mutants could be generated via one of two mechanisms. First, Wnt1-Cre-mediated loss of cilia within the neuroectoderm itself could generate the widened ventral forebrain in Wnt1-Cre;Kif3afl/fl mutants. Second, intrinsic loss of cilia on NCCs could exert an extrinsic effect on the adjacent ventral neuroectoderm.

Sox10-Cre;Kif3afl/fl mutants recapitulate both the craniofacial and brain phenotypes of Wnt1-Cre;Kif3afl/fl mutants

Previous studies in which Kif3a was conditionally deleted via the Nkx2.1-Cre driver did not report any gross morphological abnormalities (Baudoin et al., 2012), further suggesting that the ventral forebrain phenotype we observed in Wnt1-Cre;Kif3afl/fl mutants could be the result of loss of cilia on NCCs. To test this hypotheses, we implemented the Sox10-Cre driver (Matsuoka et al., 2005). Sox10-Cre is distinct from Wnt1-Cre as it mediates recombination in migratory NCCs beginning around 6 somites (Hari et al., 2012). Sox10-Cre recombination has not been detected in the neural tube, thus allowing us to test if the observed widened ventral forebrain phenotype occurred via loss of cilia on NCCs alone. We first validated where Cre-mediated recombination occurred in Sox10-Cre embryos using the dual reporter line ROSAmT/mG. ROSAmT/mG;Sox10-Cre embryos were generated and Cre-mediated recombination was examined. Robust recombination was observed in the NCCs, yet no recombination was detected in the forebrain or midbrain at any time between stages e10.5-e13.5 (Fig. 3A–D). We further confirmed NCC-specific recombination by examining cilia extension in tissue sections. We found that primary cilia extended from the ventral forebrain of both ROSAmT/mG;Sox10-Cre;Kif3afl/+ and ROSAmT/mG;Sox10- Cre;Kif3afl/fl embryos at e10.5, and that cilia were only lost on NCCs of ROSAmT/mG;Sox10-Cre;Kif3afl/fl mutants (Supp. Fig. 2).

Figure 3. Sox10-Cre;Kif3afl/fl mutants recapitulate craniofacial and ventral forebrain widening phenotypes of Wnt1-Cre;Kif3afl/fl mutants.

Figure 3

Open in a new tab

(A) Whole-mount image of ROSAmT/mG;Sox10-Cre embryo at e10.5. (B–D) Frontal sections of ROSAmT/mG;Sox10-Cre embryos at (B) e10.5, (C) e11.5, and (D) e13.5. Recombination was restricted to NCCs at multiple stages. Frontal view of whole-mount e13.5 (E) wild-type and (F) Sox10-Cre;Kif3afl/fl embryos, note the similar craniofacial phenotype between Sox10-Cre;Kif3afl/fl and Wnt1-Cre;Kif3afl/fl mutants. H&E on frontal sections of e13.5 (G) wild-type and (H) Sox10-Cre;Kif3afl/fl embryos. Sox10-Cre;Kif3afl/fl mutants had a widened ventral forebrain in the region of the third ventricle (black arrow). Surface renderings of MicroCT scans of (I) wild-type and (J) Sox10-Cre;Kif3afl/fl mutants. Frontal segmentations from MicroCT scans of e11.5 (K, 1–5) wild-type and (K, 1’-5’) Sox10-Cre;Kif3afl/fl embryos. While the ventral portion of the forebrain narrowed in more rostral segments in wild-type embryos, the ventral of forebrain Sox10-Cre;Kif3afl/fl mutants was widened and thinned (white arrows). (L) Quantification of ventral forebrain widths at multiple axial levels. Optic chiasm (oc), diencephalon (di), telencephalon (tel); P-values: (*) P<0.05, (**) P<0.01, (***) P<0.001; Scale bars: (A) 800µm, (B, C) 200 µm, (D) 650 µm, (E, F) 0.725 mm, (G, H) 650 µm, (I, J) 120 au, (K) 90 au.

Based on this analysis, we concluded that Cre-mediated recombination in the Sox10-Cre driver did not drive recombination in the ventral forebrain, and thus Sox10-Cre;Kif3afl/fl mutants could be used to test our second hypothesis that the intrinsic loss of cilia on NCCs had an extrinsic effect on the morphogenesis of the ventral forebrain. Sox10-Cre;Kif3afl/fl mutants had identical craniofacial phenotypes to Wnt1-Cre;Kif3afl/fl mutants, including midfacial widening, duplicated nasal septum, and aglossia (Fig. 3E, F, data not shown). Furthermore, we found that Sox10-Cre;Kif3afl/fl mutants recapitulated the ventral forebrain phenotype observed in Wnt1-Cre;Kif3afl/fl mutants (Fig. 3G, H and compare to Fig. 1C, D). We also performed MicroCT scans of e11.5 Sox10-Cre;Kif3afl/fl mutants to examine early forebrain morphology (Fig. 3I–K; n=3). Again, we found that the Sox10-Cre;Kif3afl/fl mutant ventral forebrain was significantly wider than wild-type forebrains and noted a similar thinning of the ventral neuroectoderm in mutants (Fig. 3K 1–5’ and compare to Fig. 1G 1–5’). These data strongly supported our previous findings and our hypothesis that intrinsic loss of cilia on NCCs exerts an extrinsic effect on the adjacent ventral neuroectoderm. We next wanted to investigate how cilia-dependent signal reception in NCCs regulates the development of the ventral forebrain.

Shh expression and neuroectodermal patterning is not altered in Wnt1-Cre;Kif3afl/fl mutants

Primary cilia are organelles essential for SHH signal transduction (Huangfu and Anderson, 2005; Huangfu et al., 2003). Shh expression has been tightly linked to midline patterning of the brain (Belloni et al., 1996; Roessler et al., 1996). Shh−/− mutants develop an alobar prosencephalon while injection of a retrovirus containing the full-length SHH into the embryonic forebrain leads to enlarged telencephalic vesicles (Rallu et al., 2002; Roessler et al., 1996). Furthermore, reduced HH signaling in the brain impacts NCC proliferation within facial prominences (Aoto and Trainor, 2015). Based on these data, we hypothesized that expanded Shh expression in the ventral forebrain of Wnt1-Cre;Kif3afl/fl mutants could generate a widened forebrain. To test this hypothesis, we performed whole-mount and sectioned in situ hybridization for Shh at multiples stages. At e9.5, Shh expression was not altered in Wnt1-Cre;Kif3afl/fl mutants (Fig. 4A, B; n=9 WT, n=2 mutant). At e10.5, Shh was induced in both the zona limitans intrathalamica (ZLI) and ventral telencephalon in wild-type and Wnt1-Cre;Kif3afl/fl mutants (Fig. 4C, D; n=10 WT, n=3 mutant). Sectioned in situ hybridization confirmed whole-mount observations. Shh expression was not changed at multiple axial levels in the ventral forebrain neuroectoderm of Wnt1-Cre;Kif3afl/fl mutants (Fig. 4E–L; n=3). Concordant with this finding, when we examined dorsal/ventral patterning markers (NKX2.1, GSX2, and PAX6) in the forebrain at e11.5, we did not observe any changes in expression levels (Supp. Fig. 3) or patterning domains (Fig. 4M–R; n=3), despite morphological changes in the ventral forebrain of Wnt1-Cre;Kif3afl/fl mutants. We also examined anterior/posterior patterning of the ventral diencephalon. While we consistently observed a thinning of the ventral neuroectoderm in this region, we did not observe any changes in patterning markers Fgf10, Bmp4, Shh, or Six3 (Supp. Fig. 4). These data indicated that aberrant ventral forebrain morphogenesis in Wnt1-Cre;Kif3afl/fl mutants is not due to intrinsic disruptions of Shh expression in the neuroectoderm.

Figure 4. Shh expression and dorsal/ventral patterning of the forebrain is normal in Wnt1-Cre;Kif3afl/fl mutants.

Figure 4

Open in a new tab

(A–D) Whole-mount and (E–L) sectioned in situ hybridization for Shh expression in (A, C, E–H) wild-type and (B, D, I–L) Wnt1-Cre;Kif3afl/fl mutants at (A, B) e9.5 and (C–L) e10.5. Frontal sections of e11.5 (M–O) wild-type and (P–R) Wnt1-Cre;Kif3afl/fl mutants immunostained for (M, P) NKX2.1, (N, Q) GSX2, and (O, R) PAX6. Zona limitans intrathalamica (zli), optic chiasm (oc), diencephalon (di), pre-optic area (poa), telencephalon (tel), medial ganglionic eminence (mge), lateral ganglionic eminence (lge); Scale bars: (A, B) 400 µm, (C, D) 500 µm, (E–L) 125 µm, (M–R) 225 µm.

Disruption of cilia-dependent Shh reception on NCCs results in widening of the ventral forebrain

While we did not detect changes in localization and expression of Shh within the neuroectoderm, and pathway potentiation within the neuroectoderm appeared to be normal, we next wondered if loss of cilia on NCCs compromised their ability to respond to a HH signal. Expression of HH receptor Patched (Ptc) is commonly used as a transcriptional readout of the HH pathway (Von Ohlen and Hooper, 1997). We next evaluated the ability of NCCs that lack primary cilia to respond to HH signaling via in situ hybridization. At e9.5, Ptc expression was indistinguishable between wild-type and Wnt1-Cre;Kif3afl/fl mutants (Fig. 5A, B; n=6 WT, n=3 mutants). In contrast, Ptc expression was reduced in the dorsal midbrain and the ventral forebrain of e10.5 Wnt1-Cre;Kif3afl/fl mutants (Fig. 5C, D, arrows; n=15 WT, n=5 mutants). Sectioned in situ hybridization revealed that Ptc expression was completely lost in the medial NCCs underlying the ventral forebrain of Wnt1-Cre;Kif3afl/fl mutants (Fig. 5E–L, asterisks; n=3). Thus, these data correlated widening of the ventral forebrain with an inability of NCCs underlying the HH signaling center of the ventral forebrain to respond to a HH signal.

Figure 5. Loss of Hedgehog-responsiveness in NCCs correlates with ventral forebrain widening.

Figure 5

Open in a new tab

(A–D) Whole-mount and (E–L) sectioned in situ hybridization for Ptc expression in (A, C, E–H) wild-type and (B, D, I–L) Wnt1-Cre;Kif3afl/fl mutants at (A, B) e9.5 and (C–L) e10.5. Arrows and asterisks denote reduced Ptc expression. H&E on frontal sections of e13.5 (M) wild-type and (N) Wnt1-Cre;Smofl/fl embryos. Wnt1-Cre;Smofl/fl mutants had a widened ventral forebrain (black arrow). Sectioned in situ hybridization for Ptc expression in (O) wild-type and (P) Wnt1-Cre;Smofl/fl mutants at e11.5. Asterisks denote reduced Ptc expression. (Q) Frontal segmentations from MicroCT scans of e11.5 (1–5) wild-type and (1’–5’) Wnt1-Cre;Smofl/fl embryos. Optic chiasm (oc), diencephalon (di), pre-optic area (poa), telencephalon (tel); Scale bars: (A, B) 400 µm, (C, D) 500 µm, (E–L), 125 µm, (M, N) 500 µm, (O, P) 100 µm, (Q) 75 au.

We next wanted to test if loss of HH-responsiveness in NCCs was sufficient to induce widening of the ventral forebrain. To test this hypothesis, we generated Wnt1-Cre;Smofl/fl mutants which lack Smoothened (SMO), an essential HH effector protein, in NCCs. Interestingly, Wnt1-Cre;Smofl/fl mutants also had a widened ventral forebrain (Fig. 5M, N) and reduced Ptc expression in NCCs underlying the ventral forebrain (Fig. 5O, P). This was strikingly similar to what was observed in Wnt1-Cre;Kif3afl/fl mutants. MicroCT analysis of Wnt1-Cre;Smofl/fl mutants at e11.5 also supported our finding that Wnt1-Cre;Smofl/fl mutants phenocopied the widened ventral forebrain phenotype of Wnt1-Cre;Kif3afl/fl mutants (Fig. 5Q 1–5’, and compare to Fig. 1G 1–5’). Together, these data suggested that cranial NCCs adjacent to the ventral forebrain regulate ventral forebrain morphogenesis via cilia-dependent signal reception of a HH signal.

Cell polarity is disrupted in Wnt1-Cre;Kif3afl/fl mutants

Despite uncovering a correlation between HH signaling and the ventral forebrain phenotype in Wnt1-Cre;Kif3afl/fl mutants, the cellular mechanism responsible for generating widening of the ventral forebrain was unclear. Primary cilia have been associated with establishing cell polarity (Higginbotham et al., 2013) and polarized cell behaviors have been associated with morphogenesis (Li et al., 2013). Thus, we wondered how loss of cilia would affect the polarity of cells in Wnt1-Cre;Kif3afl/fl mutants. To examine NCC polarity we examined Golgi orientation, a previously published technique used to determine polarity in mesenchymal cell populations in both the face and limb (Li et al., 2013; Boehm et al., 2010). The angle between the Golgi body and the nucleus in each cell was measured using the midline as a fixed axis reference point (Li et al., 2013) (Fig. 6A, A’). The population polarity of the NCCs in wild-type and Wnt1-Cre;Kif3afl/fl mutants was graphically depicted using Rose Wind plots (Fig. 6B, C). We determined that in wild-type cells the Golgi angle relative to the midline was predominantly localized between one of two cellular quadrants (Fig. 6B, n=1075, red quadrants). In Wnt1-Cre;Kif3afl/fl mutants, Golgi orientation was more evenly distributed between cell quadrants, indicating a more randomized cell polarity (Fig. 6C, n=1146). We quantified this observation by calculating the mean variance for each sample set against a perfectly randomized distribution. We found that wild-type NCCs had a higher mean variance (6.71) than Wnt1-Cre;Kif3afl/fl mutants (1.05), indicating that the population cell polarity of Wnt1-Cre;Kif3afl/fl NCCs is more randomized than that of wild-type NCCs. These data suggest that primary cilia on NCCs are required for establishing cell polarity in the developing facial mesenchyme.

Figure 6. Cell polarity is disrupted in NCCs and the ventral neuroectoderm of Wnt1-Cre;Kif3afl/fl mutants.

Figure 6

Open in a new tab

(A) Frontal section of an e10.5 wild-type embryo immunostained for GM130. (A’) Golgi angle protractor used to measure the angle between the Golgi body (red) and the nucleus. (B, C) Rose wind plot of measured Golgi body to nucleus angles relative to the embryonic midline. Frontal sections of (D, E) e11.5 and (F–K) e10.5 (D–D”, F–F”, H–H”, J–J”) wild-type and (E–E”, G–G”, I–I”, K–K”) Wnt1-Cre;Kif3afl/fl embryos immunostained for apical markers (D, E) β-catenin, (F, G) phalloidin, and (H, I) PAR3, and the basal marker (J, K) laminin. White arrows and asterisks indicated mislocalized protein or absence of protein. Scale bars: (D, E) 50 µm, (D’–E”) 20µm, (F, G) 65 µm, (F’–G”) 40 µm, (H, I) 80 µm, (H’–I”) 20 µm, (J, K) 50 µm, (J’–K”) 20 µm.

Since the morphological change we’ve focused on is in the ventral neuroectoderm adjacent to medial cranial NCCs, we next asked if polarity was also disrupted in the neuroectoderm. As an ectodermal, rather than mesenchymal population, the neuroectoderm has a defined apical-basal polarity. To test if apical-basal polarity was altered in the neuroectoderm of Wnt1-Cre;Kif3afl/fl mutants, we performed immunostaining for apical markers such as β-catenin, phalloidin, and PAR3, and the basal marker laminin. In the ventral neuroectoderm of wild-type embryos, β-catenin, phalloidin, and PAR3 were apically enriched (Fig. 6D–D”, F–F”, H–H”). In contrast, β-catenin, phalloidin, and PAR3 staining mislocalized to the presumptive basal surface and between cells, or was absent from the apical surface in the ventral neuroectoderm of Wnt1-Cre;Kif3afl/fl mutants (Fig. 6E–E”, G–G”, I–I”, arrows and asterisks). As expected, laminin staining in wild-type tissue localized exclusively to the basal side of the neuroectoderm (Fig. 6J–J”); however, patches of laminin were clearly present on the presumptive apical surface of the neuroectoderm in Wnt1-Cre;Kif3afl/fl mutants (Fig. 6K–K”, arrows). Together, these experiments support the previously reported finding that loss of cilia disrupts cell polarity, and further suggest that loss of polarity in one tissue (NCCs) can impact polarity of an adjacent tissue (neuroectoderm).

Directional cell division is skewed toward vertical divisions in Wnt1-Cre;Kif3afl/fl mutants

Previous studies have reported that polarization state of cell affects its proliferative properties (Sabherwal and Papalopulu, 2012). Furthermore, changes in proliferation are a driving force behind generating tissue morphology (Ernst, 2016). We next tested the hypothesis that widening of the ventral forebrain correlated with changes in the rate of proliferation in the ventral neuroectoderm of Wnt1-Cre;Kif3afl/fl mutants. Gross analysis of overall levels of proliferation and apoptosis did not show any difference in cell division or death between wild-type and Wnt1-Cre;Kif3afl/fl mutants (Supp. Fig. 5). Despite conserved amounts of proliferation, it is also possible that changes in the orientation of cell division can result is aberrant tissue morphology (Miyashita et al., 2017; Haldipur et al., 2015). Based on this precedence, we hypothesized that perhaps the plane of cell division (horizontal vs. vertical) in the neuroectoderm was skewed toward a vertical plane, thus promoting a wider and thinner neuroectoderm in Wnt1-Cre;Kif3afl/fl mutants. To evaluate this hypothesis, we examined the angle of cell division relative to the apical surface of the neuroectoderm of mitotic cells (via PHH3) in either anaphase or telophase (Fig. 7A–C). Our quantification revealed that wild-type neuroectodermal cells divided at an angle less than 45° (horizontal plane) 43% of the time and greater than 45° (vertical plane) 57% of the time (Fig. 7D top, D’; n=49). In Wnt1-Cre;Kif3afl/fl mutants this ratio was significantly skewed. Only 24% of mutant cells divided at an angle less than 45° (horizontal plane), whereas 76% of mutant cells divided at an angle greater than 45° (vertical plane) (Fig. 7D bottom, D’; n=51). These data suggested the angle of cell division is skewed toward vertical in Wnt1-Cre;Kif3afl/fl mutants, thus cellularly promoting a widened and thinned ventral forebrain.

Figure 7. Directional cell division of ventral forebrain neuroectodermal cells is skewed toward vertical in both ciliopathic and HH mutants.

Figure 7

Open in a new tab

(A–C) Representative images of anaphase or telophase neuroectodermal cells undergoing oriented cell division. (D, D’) Quantification of the angle of neuroectodermal cell division in wild-type and Wnt1-Cre;Kif3afl/fl mutants. (E, E’) Quantification of the angle of neuroectodermal cell division in wild-type and Wnt1-Cre;Smofl/fl mutants. (*) P< 0.05

Since we had previously determined that cilia-dependent HH signaling was impaired in Wnt1-Cre;Kif3afl/fl mutants, we next wanted to confirm that the skewing in division plane was associated with aberrant HH signaling. To do so, we repeated our cell division analyses with Wnt1-Cre;Smofl/fl mutant embryos, that have a similar widened ventral forebrain. Our quantification revealed that wild-type neuroectodermal cells divided at an angle less than 45° (horizontal plane) 52% of the time and greater than 45° (vertical plane) 48% of the time (Fig. 7E top, E’; n=23). In Wnt1-Cre;Smofl/fl mutants this ratio was significantly skewed. Only 19% of mutant cells divided at an angle less than 45° (horizontal plane), whereas 81% of mutant cells divided at an angle greater than 45° (vertical plane) (Fig. 7E bottom, E’; n=26). Together, these data suggested the aberrant HH-signaling was correlated with disruptions in the angle of cell division, thus cellularly promoting a wider and thinner ventral forebrain in both ciliary (Wnt1-Cre;Kif3afl/fl) and HH (Wnt1-Cre;Smofl/fl) mutants.

Discussion

In this work, we identified an extrinsic role for cilia-mediated HH signaling in NCCs on the development of the ventral forebrain. We found that molecularly, a widened ventral forebrain in conditional ciliopathic mutants correlated with a loss of HH responsiveness in NCCs adjacent to the ventral forebrain. Furthermore, genetic ablation of Smoothened from NCCs also phenocopied the widened ventral forebrain phenotype observed in the conditional ciliary mutants. Cellularly, the widened ventral forebrain in Wnt1-Cre;Kif3afl/fl mutants correlated with disrupted polarity in both the NCCs and the ventral neuroectoderm. Finally, we observed a significant increase in the number of vertically oriented cell divisions in the ventral neuroectoderm, suggesting a mechanism to explain the wider, thinner tissue. Together, these data suggested that loss of cilia on NCCs prevented NCCs from being able to respond to a SHH signal from the ventral neuroectoderm and altered their polarity (Fig. 8). Subsequently, NCCs could not signal back to the neuroectoderm and the polarity of the neuroectoderm was also disrupted. Furthermore, cell division within the neuroectoderm was skewed towards a vertical division plane, producing a wider and thinner ventral forebrain (Fig. 8). Taken together, these data implicate a novel role for cilia-dependent HH signaling in NCCs on the regulation of ventral forebrain morphogenesis.

Figure 8. Schematic of hypothesized model for ventral forebrain widening.

Figure 8

Open in a new tab

(A, E) SHH from the ventral forebrain signals to the underlying NCCs. (B) In wild-type embryos, NCCs are competent to respond to the SHH signal and express Ptc. (C) Primary cilia and SHH-responsiveness are required for maintaining cell polarity and (C’) directional cell division, thus promoting (D) normal morphogenesis. In Wnt1-Cre;Kif3afl/fl mutants, (F) NCCs lack cilia and are unable to respond to the SHH signal and fail to express Ptc. Consequentially, (G) NCC polarity and the apical/basal polarity of the ventral neuroectoderm is disrupted and (G’) directional cell division is skewed toward vertical in the ventral neuroectoderm. The morphological consequence of these cellular changes is (H) a wider and thinner ventral forebrain.

The relationship between NCCs and the developing brain

Previous experiments in chick have demonstrated that NCCs are the source of molecular signals essential for establishing critical forebrain signaling centers (Creuzet et al., 2004; Creuzet et al., 2006; Cruezet 2009; Etchevers et al., 1999; LeDouarin et al., 2007). Our work adds to the known relationship between NCCs within the developing cranial midline and the ventral forebrain by demonstrating that a loss of cilia-dependent HH-responsiveness in NCCs correlated with ventral neuroectodermal widening. This work, in tandem with the work of others (Chong et al., 2012; Hu et al., 2015; Marcucio et al., 2005; Petryk et al., 2015), suggests that NCCs are involved in a bidirectional signaling cascade. Understanding the tissue of origin and timing of signals between NCCs and the brain will help unveil how these two organs coordinate their development. Additionally, the establishment of the FEZ, an ectodermal Shh signaling center (Hu et al., 2003), has been directly linked to signals from the ventral forebrain. This signaling center, in turn, instructs NCCs during facial formation. Thus, understanding how these three tissues function together to direct brain and craniofacial development is of prime interest for understanding the molecular and cellular origins of many human syndromes.

Our previous work with the Wnt1-Cre;Kif3afl/fl mutant explored the molecular origins of midfacial widening in these mutants. We found that the transcriptional effectors of the HH pathway, the GLI proteins, did not undergo proper post-translational processing in the frontonasal prominence. We specifically found increased GLI2/3 full-length isoforms were produced at the expense of the truncated repressor isoforms (Chang et al., 2016). These data suggested that the transcriptional targets of the HH pathway in NCCs might not be appropriately regulated in the midface. Analysis of GLI protein processing was not performed on the population of NCCs underlying the ventral forebrain due to technical limitations; therefore, we could not draw conclusions about aberrant GLI processing causing this phenotype. Still, it is likely that GLI-processing is aberrant in the NCCs adjacent to the widened ventral forebrain in Wnt1-Cre;Kif3afl/fl and Sox10-Cre;Kif3afl/fl mutants. Identifying GLI targets in the NCC that could regulate forebrain development and examining their expression in this domain is the focus of future work in the lab.

Loss of primary cilia impacts cell polarity

Primary cilia are known to extend from the apical surface of an epithelium and loss of cilia has previously been associated with polarity defects (Luo et al., 2017; Higginbotham et al., 2013). We examined how loss of cilia affected a mesenchymal population of cells, the NCCs. NCCs without cilia had a more randomized polarity, relative to wild-type NCCs (Fig. 6). Interestingly, a previous study observed polarity defects in NCCs and aberrant facial growth as a consequence of ectopic FGF signaling (Li et al., 2013). Given that cilia have been implicated as a signaling hub for several molecular pathways, further understanding how cilia interpret molecular signals to guide cellular behaviors could prove useful in understanding the etiology of craniofacial anomalies.

In addition to observing defects in NCC polarity, we also determined that apical/basal polarity of the ventral forebrain neuroectoderm was also disrupted in Wnt1-Cre;Kif3afl/fl mutants. These findings were of particular interest, as they suggested that intrinsic changes in NCC polarity could impact polarity in the adjacent neuroectoderm. While our studies do not conclusively prove this, we can theorize how this could occur. In epithelial cells, apical/basal polarity is established through interactions between integrin receptors and the underlying extra cellular matrix (ECM). This leads to the appropriate localization of laminin on the basal surface of the cell and, consequentially, restriction of apical proteins to the opposite surface (Lee and Streuli, 2014). There are multiple ligands for integrins, two of which are focal adhesion kinase (FAK) and paxillin (Harburger and Calderwood, 2009). Wnt1-Cre;Kif3afl/fl mutants have fewer NCCs underlying the ventral forebrain neuroectoderm (Supp. Fig. 1). Thus, it is possible that there are fewer integrin ligands available to the neuroectoderm leading to disruptions in polarity. Alternatively, it is plausible that the composition of the ECM differs in Wnt1-Cre;Kif3afl/fl mutants either due to a deficiency of NCCs or loss of HH-responsiveness in that region.

HH-mediated oriented cell division is essential for neuroectodermal morphogenesis

Aberrant morphology during development is frequently associated with alterations in the amount and orientation of proliferation (Ernst, 2016), and there is precedent for cilia-dependent HH signaling mediating cell survival to coordinate the growth of the brain and the face (Aoto et al., 2015). Both the ciliopathic (Wnt1-Cre;Kif3afl/fl) and HH (Wnt1-Cre;Smofl/fl) mutants we examined had a wider and thinner ventral forebrain (Figs. 1 & 5). Although we did not observe a change in the amount of proliferation, we confirmed that both the loss of cilia and the loss of HH signaling in NCCs significantly skewed the orientation of cell division towards the vertical division plane (Fig. 7). We hypothesize that this skewing towards vertical division then impacted the directional growth and eventual morphology of the ventral forebrain to a wider, thinner morphology. Interestingly, recent studies suggest HH signaling regulates the orientation of cell division. Adding a SHH inhibitor to cultured cerebellar slices resulted in randomized orientation of granule cell precursor division (Miyashita et al., 2017; Haldipur et al 2015). Conditional activation of the HH effector, SMO (SmoM2) in the ventricular zone shifted the orientation of division in the apical radial glia (Wang et al., 2017). Our study suggest that this is a ciliary-dependent function and open the possibility of cilia-mediated approaches for directing tissue growth.

Despite supportive evidence for a role of HH in mediating the plane of cell division, the exact mechanism for how HH signaling impacts cell division remains unclear. The cilium has been previously linked to cell division due to the role the centrioles play in each both ciliogenesis and mitosis. The centrioles of the cilia are necessary for assembly and docking of the primary cilia to the cell membrane. During mitosis, however, centrioles participate in the organization and orientation of the spindle (Luders and Stearns, 2007; O’Connell and Wang 2000, Toyoshima and Nishida 2007). Ciliary proteins have also been implicated in establishing spindle orientation and plane of cell division (Delaval et al., 2011). Understanding the link between primary cilium, HH signaling, and establishing the plane of cell division could have a significant impact on understanding the mechanisms that mediate tissue morphology, cell differentiation, and congenital defects that affect the craniofacial complex.

Conclusions

The data presented in this work indicate that NCCs influence the development of the ventral forebrain. Thus, defects in the brain or the face can result in morphological changes in the other tissue (e.g., HPE). When examining a patient with a syndrome primarily defined by defects in the brain and/or face, it may be valuable to examine the reciprocal structure for defects that might also require clinical intervention. While this would be especially informative for patients diagnosed with ciliopathies, such as Oral-facial-digital syndrome, it could be extended to other syndromes and lead to more complete patient care.

Supplementary Material

1. Supplemental Figure 1. Wnt1-Cre;Kif3afl/fl mutants have a reduced number of NCCs adjacent to the widened ventral forebrain.

Frontal section of (A) wild-type and (B) Wnt1-Cre;Kif3afl/fl embryos stained for DAPI. White lines indicate area in which NCCs were counted. (C) Quantification of NCC counts. P-value: (*) P<0.0001. Scale bars: (A, B) 100 µm.

2. Supplemental Figure 2. Primary cilia still extend from the ventral forebrain in Sox10-Cre;Kif3afl/fl mutants.

Frontal sections of (A) ROSAmT/mG;Sox10-Cre;Kif3afl/+ and (B) ROSAmT/mG;Sox10-Cre;Kif3afl/fl embryos at e10.5. ARL13B immunostaining assaying cilia extension in (C, E) ROSAmT/mG;Sox10-Cre;Kif3afl/+ and (D, F) ROSAmT/mG;Sox10-Cre;Kif3afl/fl embryos. Primary cilia extend (white arrows) from (C) recombined NCCs in ROSAmT/mG;Sox10-Cre;Kif3afl/+ embryos, but are lost in (D) NCCs from ROSAmT/mG;Sox10-Cre;Kif3afl/fl mutants. Cilia extend (white arrows) from the ventral neuroectoderm of both (E) ROSAmT/mG;Sox10-Cre;Kif3afl/+ and (F) ROSAmT/mG;Sox10-Cre;Kif3afl/fl embryos. Neural crest cells (ncc), neuroectoderm (ne); Scale bars: (A, B) 200 µm, (C–F) 15 µm.

3. Supplemental Figure 3. Gene expression fold change for dorsal/ventral patterning markers.

Gene expression fold change (normalized to WT) for Nxk2.1, Gsx2, and Pax6 from RNA-seq data from e11.5 wild-type and Wnt1-Cre; Kif3afl/fl mutants.

4. Supplemental Figure 4. Anterior/posterior patterning of Wnt1-Cre;Kif3afl/fl forebrains is normal.

Sectioned in situ hybridization on sagittal sections of e10.5 (A, C, E, G) wild-type and (B, D, F, H) Wnt1-Cre;Kif3afl/fl mutants for (A, B) Fgf10, (C, D) Bmp4, (E, F) Shh, and (G, H) Six3. Anterior/posterior patterning of the ventral diencephalon is not altered in Wnt1-Cre;Kif3afl/fl mutants. Telencephalon (tel), Rathke’s pouch (rp); Scale bar: 175 µm.

5. Supplemental Figure 5. Cell proliferation and cell death in the ventral neuroectoderm of Wnt1-Cre;Kif3afl/fl mutants is not altered.

Frontal section of (A) wild-type and (B) Wnt1-Cre;Kif3afl/fl embryos immunostained for PHH3. (C) Quantification of the number of PHH3+ cells normalized over neuroectodermal length indicated that there was no significant change in the amount of proliferation. Frontal section of (D) wild-type and (E) Wnt1-Cre;Kif3afl/fl embryos with TUNEL staining. (C) Quantification of the number of TUNEL+ cells normalized over neuroectodermal length indicated that there was no significant change in the amount of cell death. Scale bars: (A, B, D, E) 100 µm.

Highlights.

  • Neural crest cells (NCCs) regulate ventral forebrain morphogenesis.

  • Loss of primary cilia on NCCs causes ventral forebrain widening.

  • Shh expression and forebrain patterning are unchanged in ciliary mutants.

  • Loss of Smoothened in NCCs recapitulates ciliopathic ventral forebrain widening.

  • Loss of cilia on NCCs affects oriented cell division in the neuroectoderm.

Acknowledgments

We would like to thank John Pearce from the Imaging Research Center, Cincinnati Children’s Hospital Medical Center for assistance with the MicroCT scans, and Ralph Marcucio and members of the Brugmann lab for helpful discussions. This research was supported by National Institutes of Health (NIH)/National Institute of Dental and Craniofacial Research (NIDCR) grants R01DE023804 (S.A.B) and F31DE025537 (E.N.S), and by Cincinnati Children’s Research Foundation Trustee Grant (S.A.B).

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

  1. Acloque H, Wilkinson DG, Nieto MA. In situ hybridization analysis of chick embryos in whole-mount and tissue sections. Methods in cell biology. 2008;87:169–185. doi: 10.1016/S0091-679X(08)00209-4. [DOI] [PubMed] [Google Scholar]
  2. Aoto K, Trainor PA. Co-ordinated brain and craniofacial development depend upon Patched1/XIAP regulation of cell survival. Hum Mol Genet. 2015;24:698–713. doi: 10.1093/hmg/ddu489. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Bahm I, Barriga EH, Frolov A, Theveneau E, Frankel P, Mayor R. PDGF controls contact inhibition of locomotion by regulating N-cadherin during neural crest migration. Development. 2017 doi: 10.1242/dev.147926. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Baudoin JP, Viou L, Launay PS, Luccardini C, Espeso Gil S, Kiyasova V, Irinopoulou T, Alvarez C, Rio JP, Boudier T, et al. Tangentially migrating neurons assemble a primary cilium that promotes their reorientation to the cortical plate. Neuron. 2012;76:1108–1122. doi: 10.1016/j.neuron.2012.10.027. [DOI] [PubMed] [Google Scholar]
  5. Boehm B, Westerberg H, Lesnicar-Pucko G, Raja S, Rautschka M, Cotterell J, Swoger J, Sharpe J. The role of spatially controlled cell proliferation in limb bud morphogenesis. 2010 doi: 10.1371/journal.pbio.1000420. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Bronner ME, LeDouarin NM. Development and evolution of the neural crest: an overview. Developmental biology. 2012;366:2–9. doi: 10.1016/j.ydbio.2011.12.042. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Brugmann SA, Allen NC, James AW, Mekonnen Z, Madan E, Helms JA. A primary cilia-dependent etiology for midline facial disorders. Human molecular genetics. 2010;19:1577–1592. doi: 10.1093/hmg/ddq030. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Buitrago-Delgado E, Nordin K, Rao A, Geary L, LaBonne C. NEURODEVELOPMENT. Shared regulatory programs suggest retention of blastula-stage potential in neural crest cells. Science. 2015;348:1332–1335. doi: 10.1126/science.aaa3655. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Caspary T, Larkins CE, Anderson KV. The graded response to Sonic Hedgehog depends on cilia architecture. Dev Cell. 2007;12:767–778. doi: 10.1016/j.devcel.2007.03.004. [DOI] [PubMed] [Google Scholar]
  10. Chai Y, Jiang X, Ito Y, Bringas P, Jr, Han J, Rowitch DH, Soriano P, McMahon AP, Sucov HM. Fate of the mammalian cranial neural crest during tooth and mandibular morphogenesis. Development. 2000;127:1671–1679. doi: 10.1242/dev.127.8.1671. [DOI] [PubMed] [Google Scholar]
  11. Chang CF, Chang YT, Millington G, Brugmann SA. Craniofacial Ciliopathies Reveal Specific Requirements for GLI Proteins during Development of the Facial Midline. PLoS genetics. 2016;12:e1006351. doi: 10.1371/journal.pgen.1006351. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Chang CF, Schock EN, Attia AC, Stottmann RW, Brugmann SA. The ciliary baton: orchestrating neural crest cell development. Current topics in developmental biology. 2015;111:97–134. doi: 10.1016/bs.ctdb.2014.11.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Choe Y, Zarbalis KS, Pleasure SJ. Neural crest-derived mesenchymal cells require Wnt signaling for their development and drive invagination of the telencephalic midline. PloS one. 2014;9:e86025. doi: 10.1371/journal.pone.0086025. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Chong HJ, Young NM, Hu D, Jeong J, McMahon AP, Hallgrimsson B, Marcucio RS. Signaling by SHH rescues facial defects following blockade in the brain. Developmental dynamics : an official publication of the American Association of Anatomists. 2012;241:247–256. doi: 10.1002/dvdy.23726. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Creuzet S, Couly G, Vincent C, Le Douarin NM. Negative effect of Hox gene expression on the development of the neural crest-derived facial skeleton. Development. 2002;129:4301–4313. doi: 10.1242/dev.129.18.4301. [DOI] [PubMed] [Google Scholar]
  16. Creuzet S, Schuler B, Couly G, Le Douarin NM. Reciprocal relationships between Fgf8 and neural crest cells in facial and forebrain development. Proceedings of the National Academy of Sciences of the United States of America. 2004;101:4843–4847. doi: 10.1073/pnas.0400869101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Creuzet SE, Martinez S, Le Douarin NM. The cephalic neural crest exerts a critical effect on forebrain and midbrain development. Proceedings of the National Academy of Sciences of the United States of America. 2006;103:14033–14038. doi: 10.1073/pnas.0605899103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Creuzet SE. Neural crest contribution to forebrain development. Seminars in cell & developmental biology. 2009;20:751–759. doi: 10.1016/j.semcdb.2009.05.009. [DOI] [PubMed] [Google Scholar]
  19. Danielian PS, Muccino D, Rowitch DH, Michael SK, McMahon AP. Modification of gene activity in mouse embryos in utero by a tamoxifen-inducible form of Cre recombinase. Current biology : CB. 1998;8:1323–1326. doi: 10.1016/s0960-9822(07)00562-3. [DOI] [PubMed] [Google Scholar]
  20. Delaval B, Bright A, Lawson ND, Doxsey S. The cilia protein IFT88 is required for spindle orientation in mitosis. Nat Cell Biol. 2011;13:461–468. doi: 10.1038/ncb2202. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Diewert VM, Lozanoff S. A morphometric analysis of human embryonic craniofacial growth in the median plane during primary palate formation. Journal of craniofacial genetics and developmental biology. 1993;13:147–161. [PubMed] [Google Scholar]
  22. Eggenschwiler JT, Anderson KV. Cilia and developmental signaling. Annual review of cell and developmental biology. 2007;23:345–373. doi: 10.1146/annurev.cellbio.23.090506.123249. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Ernst C. Proliferation and Differentiation Deficits are a Major Convergence Point for Neurodevelopmental Disorders. Trends in neurosciences. 2016;39:290–299. doi: 10.1016/j.tins.2016.03.001. [DOI] [PubMed] [Google Scholar]
  24. Etchevers HC, Couly G, Vincent C, Le Douarin NM. Anterior cephalic neural crest is required for forebrain viability. Development. 1999;126:3533–3543. doi: 10.1242/dev.126.16.3533. [DOI] [PubMed] [Google Scholar]
  25. Garcez RC, Le Douarin NM, Creuzet SE. Combinatorial activity of Six1–2–4 genes in cephalic neural crest cells controls craniofacial and brain development. Cellular and molecular life sciences : CMLS. 2014;71:2149–2164. doi: 10.1007/s00018-013-1477-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Haldipur P, Sivaprakasam I, Periasamy V, Govindan S, Mani S. Asymmetric cell division of granule neuron progenitors in the external granule layer of the mouse cerebellum. Biology open. 2015;4:865–872. doi: 10.1242/bio.009886. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Harburger DS, Calderwood DA. Integrin signalling at a glance. Journal of cell science. 2009;122:159–163. doi: 10.1242/jcs.018093. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Hardcastle Z, Mo R, Hui CC, Sharpe PT. The Shh signalling pathway in tooth development: defects in Gli2 and Gli3 mutants. Development. 1998;125:2803–2811. doi: 10.1242/dev.125.15.2803. [DOI] [PubMed] [Google Scholar]
  29. Hari L, Miescher I, Shakhova O, Suter U, Chin L, Taketo M, Richardson WD, Kessaris N, Sommer L. Temporal control of neural crest lineage generation by Wnt/beta-catenin signaling. Development. 2012;139:2107–2117. doi: 10.1242/dev.073064. [DOI] [PubMed] [Google Scholar]
  30. Heisenberg CP, Bellaiche Y. Forces in tissue morphogenesis and patterning. Cell. 2013;153:948–962. doi: 10.1016/j.cell.2013.05.008. [DOI] [PubMed] [Google Scholar]
  31. Higginbotham H, Guo J, Yokota Y, Umberger NL, Su CY, Li J, Verma N, Hirt J, Ghukasyan V, Caspary T, Anton ES. Arl13b-regulated cilia activities are essential for polarized radial glial scaffold formation. Nat Neurosci. 2013;16:1000–1007. doi: 10.1038/nn.3451. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Hu D, Marcucio RS, Helms JA. A zone of frontonasal ectoderm regulates patterning and growth in the face. Development. 2003;130:1749–1758. doi: 10.1242/dev.00397. [DOI] [PubMed] [Google Scholar]
  33. Hu D, Young NM, Xu Q, Jamniczky H, Green RM, Mio W, Marcucio RS, Hallgrimsson B. Signals from the brain induce variation in avian facial shape. Developmental dynamics : an official publication of the American Association of Anatomists. 2015 doi: 10.1002/dvdy.24284. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Huangfu D, Liu A, Rakeman AS, Murcia NS, Niswander L, Anderson KV. Hedgehog signalling in the mouse requires intraflagellar transport proteins. Nature. 2003;426:83–87. doi: 10.1038/nature02061. [DOI] [PubMed] [Google Scholar]
  35. Huangfu D, Anderson KV. Cilia and Hedgehog responsiveness in the mouse. Proc Natl Acad Sci U S A. 2005;102:11325–11330. doi: 10.1073/pnas.0505328102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Jacques-Fricke BT, Roffers-Agarwal J, Gammill LS. DNA methyltransferase 3b is dispensable for mouse neural crest development. PloS one. 2012;7:e47794. doi: 10.1371/journal.pone.0047794. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Le Douarin NM, Creuzet S, Couly G, Dupin E. Neural crest cell plasticity and its limits. Development. 2004;131:4637–4650. doi: 10.1242/dev.01350. [DOI] [PubMed] [Google Scholar]
  38. Le Douarin NM, Brito JM, Creuzet S. Role of the neural crest in face and brain development. Brain Res Rev. 2007;55:237–247. doi: 10.1016/j.brainresrev.2007.06.023. [DOI] [PubMed] [Google Scholar]
  39. Lee JL, Streuli CH. Integrins and epithelial cell polarity. Journal of cell science. 2014;127:3217–3225. doi: 10.1242/jcs.146142. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Lewis AE, Vasudevan HN, O'Neill AK, Soriano P, Bush JO. The widely used Wnt1-Cre transgene causes developmental phenotypes by ectopic activation of Wnt signaling. Developmental biology. 2013;379:229–234. doi: 10.1016/j.ydbio.2013.04.026. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Li X, Young NM, Tropp S, Hu D, Xu Y, Hallgrimsson B, Marcucio RS. Quantification of shape and cell polarity reveals a novel mechanism underlying malformations resulting from related FGF mutations during facial morphogenesis. Hum Mol Genet. 2013;22:5160–5172. doi: 10.1093/hmg/ddt369. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Luders J, Stearns T. Microtubule-organizing centres: a re-evaluation. Nat Rev Mol Cell Biol. 2007;8:161–167. doi: 10.1038/nrm2100. [DOI] [PubMed] [Google Scholar]
  43. Marcucio RS, Cordero DR, Hu D, Helms JA. Molecular interactions coordinating the development of the forebrain and face. Developmental biology. 2005;284:48–61. doi: 10.1016/j.ydbio.2005.04.030. [DOI] [PubMed] [Google Scholar]
  44. Matsuoka T, Ahlberg PE, Kessaris N, Iannarelli P, Dennehy U, Richardson WD, McMahon AP, Koentges G. Neural crest origins of the neck and shoulder. Nature. 2005;436:347–355. doi: 10.1038/nature03837. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Millington G, Elliott KH, Chang YT, Chang CF, Dlugosz A, Brugmann SA. Cilia-dependent GLI processing in neural crest cells is required for tongue development. Developmental biology. 2017 doi: 10.1016/j.ydbio.2017.02.021. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Miyashita S, Adachi T, Yamashita M, Sota T, Hoshino M. Dynamics of the cell division orientation of granule cell precursors during cerebellar development. Mech Dev. 2017 doi: 10.1016/j.mod.2017.06.002. [DOI] [PubMed] [Google Scholar]
  47. Muzumdar MD, Tasic B, Miyamichi K, Li L, Luo L. A global double-fluorescent Cre reporter mouse. Genesis. 2007;45:593–605. doi: 10.1002/dvg.20335. [DOI] [PubMed] [Google Scholar]
  48. Noden DM, Trainor PA. Relations and interactions between cranial mesoderm and neural crest populations. Journal of anatomy. 2005;207:575–601. doi: 10.1111/j.1469-7580.2005.00473.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. O'Connell CB, Wang YL. Mammalian spindle orientation and position respond to changes in cell shape in a dynein-dependent fashion. Mol Biol Cell. 2000;11:1765–1774. doi: 10.1091/mbc.11.5.1765. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Petryk A, Graf D, Marcucio R. Holoprosencephaly: signaling interactions between the brain and the face, the environment and the genes, and the phenotypic variability in animal models and humans. Wiley interdisciplinary reviews. Developmental biology. 2015;4:17–32. doi: 10.1002/wdev.161. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Rallu M, Machold R, Gaiano N, Corbin JG, McMahon AP, Fishell G. Dorsoventral patterning is established in the telencephalon of mutants lacking both Gli3 and Hedgehog signaling. Development. 2002;129:4963–4974. doi: 10.1242/dev.129.21.4963. [DOI] [PubMed] [Google Scholar]
  52. Rice R, Connor E, Rice DP. Expression patterns of Hedgehog signalling pathway members during mouse palate development. Gene expression patterns : GEP. 2006;6:206–212. doi: 10.1016/j.modgep.2005.06.005. [DOI] [PubMed] [Google Scholar]
  53. Roessler E, Belloni E, Gaudenz K, Jay P, Berta P, Scherer SW, Tsui LC, Muenke M. Mutations in the human Sonic Hedgehog gene cause holoprosencephaly. Nature genetics. 1996;14:357–360. doi: 10.1038/ng1196-357. [DOI] [PubMed] [Google Scholar]
  54. Roessler E, Belloni E, Gaudenz K, Vargas F, Scherer SW, Tsui LC, Muenke M. Mutations in the C-terminal domain of Sonic Hedgehog cause holoprosencephaly. Hum Mol Genet. 1997;6:1847–1853. doi: 10.1093/hmg/6.11.1847. [DOI] [PubMed] [Google Scholar]
  55. Rohatgi R, Milenkovic L, Scott MP. Patched1 regulates hedgehog signaling at the primary cilium. Science. 2007;317:372–376. doi: 10.1126/science.1139740. [DOI] [PubMed] [Google Scholar]
  56. Sabherwal N, Papalopulu N. Apicobasal polarity and cell proliferation during development. Essays Biochem. 2012;53:95–109. doi: 10.1042/bse0530095. [DOI] [PubMed] [Google Scholar]
  57. Schneider L, Cammer M, Lehman J, Nielsen SK, Guerra CF, Veland IR, Stock C, Hoffmann EK, Yoder BK, Schwab A, Satir P, Christensen ST. Directional cell migration and chemotaxis in wound healing response to PDGF-AA are coordinated by the primary cilium in fibroblasts. Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology. 2010;25:279–292. doi: 10.1159/000276562. [DOI] [PMC free article] [PubMed] [Google Scholar]
  58. Schock EN, Brugmann SA. Discovery, Diagnosis, and Etiology of Craniofacial Ciliopathies. Cold Spring Harbor perspectives in biology. 2017 doi: 10.1101/cshperspect.a028258. [DOI] [PMC free article] [PubMed] [Google Scholar]
  59. Schock EN, Chang CF, Struve JN, Chang YT, Chang J, Delany ME, Brugmann SA. Using the avian mutant talpid2 as a disease model for understanding the oral-facial phenotypes of Oral-facial-digital syndrome. Disease models & mechanisms. 2015 doi: 10.1242/dmm.020222. [DOI] [PMC free article] [PubMed] [Google Scholar]
  60. Snedeker J, Schock EN, Struve JN, Chang CF, Cionni M, Tran PV, Brugmann SA, Stottmann RW. Unique spatiotemporal requirements for intraflagellar transport genes during forebrain development. PloS one. 2017;12:e0173258. doi: 10.1371/journal.pone.0173258. [DOI] [PMC free article] [PubMed] [Google Scholar]
  61. Stramer B, Mayor R. Mechanisms and in vivo functions of contact inhibition of locomotion. Nature reviews. Molecular cell biology. 2016 doi: 10.1038/nrm.2016.118. [DOI] [PubMed] [Google Scholar]
  62. Streit A, Stern CD. Combined whole-mount in situ hybridization and immunohistochemistry in avian embryos. Methods. 2001;23:339–344. doi: 10.1006/meth.2000.1146. [DOI] [PubMed] [Google Scholar]
  63. Tabler JM, Barrell WB, Szabo-Rogers HL, Healy C, Yeung Y, Perdiguero EG, Schulz C, Yannakoudakis BZ, Mesbahi A, Wlodarczyk B, Geissmann F, Finnell RH, Wallingford JB, Liu KJ. Fuz mutant mice reveal shared mechanisms between ciliopathies and FGF-related syndromes. Developmental cell. 2013;25:623–635. doi: 10.1016/j.devcel.2013.05.021. [DOI] [PMC free article] [PubMed] [Google Scholar]
  64. Tobin JL, Di Franco M, Eichers E, May-Simera H, Garcia M, Yan J, Quinlan R, Justice MJ, Hennekam RC, Briscoe J, Tada M, Mayor R, Burns AJ, Lupski JR, Hammond P, Beales PL. Inhibition of neural crest migration underlies craniofacial dysmorphology and Hirschsprung's disease in Bardet-Biedl syndrome. Proceedings of the National Academy of Sciences of the United States of America. 2008;105:6714–6719. doi: 10.1073/pnas.0707057105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  65. Tolosa EJ, Fernandez-Zapico ME, Battiato NL, Rovasio RA. Sonic hedgehog is a chemotactic neural crest cell guide that is perturbed by ethanol exposure. European journal of cell biology. 2016;95:136–152. doi: 10.1016/j.ejcb.2016.02.003. [DOI] [PubMed] [Google Scholar]
  66. Toresson H, Potter SS, Campbell K. Genetic control of dorsal-ventral identity in the telencephalon: opposing roles for Pax6 and Gsh2. Development. 2000;127:4361–4371. doi: 10.1242/dev.127.20.4361. [DOI] [PubMed] [Google Scholar]
  67. Torii D, Soeno Y, Fujita K, Sato K, Aoba T, Taya Y. Embryonic tongue morphogenesis in an organ culture model of mouse mandibular arches: blocking Sonic hedgehog signaling leads to microglossia. In vitro cellular & developmental biology. Animal. 2016;52:89–99. doi: 10.1007/s11626-015-9951-6. [DOI] [PubMed] [Google Scholar]
  68. Toyoshima F, Nishida E. Spindle orientation in animal cell mitosis: roles of integrin in the control of spindle axis. J Cell Physiol. 2007;213:407–411. doi: 10.1002/jcp.21227. [DOI] [PubMed] [Google Scholar]
  69. Von Ohlen T, Hooper JE. Hedgehog signaling regulates transcription through Gli/Ci binding sites in the wingless enhancer. Mechanisms of development. 1997;68:149–156. doi: 10.1016/s0925-4773(97)00150-0. [DOI] [PubMed] [Google Scholar]
  70. Wang L, Hou S, Han YG. Hedgehog signaling promotes basal progenitor expansion and the growth and folding of the neocortex. Nat Neurosci. 2016;19:888–896. doi: 10.1038/nn.4307. [DOI] [PMC free article] [PubMed] [Google Scholar]
  71. Willaredt MA, Tasouri E, Tucker KL. Primary cilia and forebrain development. Mechanisms of development. 2013;130:373–380. doi: 10.1016/j.mod.2012.10.003. [DOI] [PubMed] [Google Scholar]
  72. Xu GK, Liu Y, Zheng Z. Oriented cell division affects the global stress and cell packing geometry of a monolayer under stretch. Journal of biomechanics. 2016;49:401–407. doi: 10.1016/j.jbiomech.2015.12.046. [DOI] [PubMed] [Google Scholar]
  73. Yamanishi E, Takahashi M, Saga Y, Osumi N. Penetration and differentiation of cephalic neural crest-derived cells in the developing mouse telencephalon. Development, growth & differentiation. 2012;54:785–800. doi: 10.1111/dgd.12007. [DOI] [PubMed] [Google Scholar]
  74. Yang S, Ma K, Geng Z, Sun X, Fu X. Oriented cell division: new roles in guiding skin wound repair and regeneration. Bioscience reports. 2015;35 doi: 10.1042/BSR20150225. [DOI] [PMC free article] [PubMed] [Google Scholar]
  75. Zaghloul NA, Brugmann SA. The emerging face of primary cilia. Genesis. 2011;49:231–246. doi: 10.1002/dvg.20728. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

1. Supplemental Figure 1. Wnt1-Cre;Kif3afl/fl mutants have a reduced number of NCCs adjacent to the widened ventral forebrain.

Frontal section of (A) wild-type and (B) Wnt1-Cre;Kif3afl/fl embryos stained for DAPI. White lines indicate area in which NCCs were counted. (C) Quantification of NCC counts. P-value: (*) P<0.0001. Scale bars: (A, B) 100 µm.

NIHMS910725-supplement-1.jpg (798.9KB, jpg)
2. Supplemental Figure 2. Primary cilia still extend from the ventral forebrain in Sox10-Cre;Kif3afl/fl mutants.

Frontal sections of (A) ROSAmT/mG;Sox10-Cre;Kif3afl/+ and (B) ROSAmT/mG;Sox10-Cre;Kif3afl/fl embryos at e10.5. ARL13B immunostaining assaying cilia extension in (C, E) ROSAmT/mG;Sox10-Cre;Kif3afl/+ and (D, F) ROSAmT/mG;Sox10-Cre;Kif3afl/fl embryos. Primary cilia extend (white arrows) from (C) recombined NCCs in ROSAmT/mG;Sox10-Cre;Kif3afl/+ embryos, but are lost in (D) NCCs from ROSAmT/mG;Sox10-Cre;Kif3afl/fl mutants. Cilia extend (white arrows) from the ventral neuroectoderm of both (E) ROSAmT/mG;Sox10-Cre;Kif3afl/+ and (F) ROSAmT/mG;Sox10-Cre;Kif3afl/fl embryos. Neural crest cells (ncc), neuroectoderm (ne); Scale bars: (A, B) 200 µm, (C–F) 15 µm.

NIHMS910725-supplement-2.jpg (1.3MB, jpg)
3. Supplemental Figure 3. Gene expression fold change for dorsal/ventral patterning markers.

Gene expression fold change (normalized to WT) for Nxk2.1, Gsx2, and Pax6 from RNA-seq data from e11.5 wild-type and Wnt1-Cre; Kif3afl/fl mutants.

NIHMS910725-supplement-3.jpg (552.5KB, jpg)
4. Supplemental Figure 4. Anterior/posterior patterning of Wnt1-Cre;Kif3afl/fl forebrains is normal.

Sectioned in situ hybridization on sagittal sections of e10.5 (A, C, E, G) wild-type and (B, D, F, H) Wnt1-Cre;Kif3afl/fl mutants for (A, B) Fgf10, (C, D) Bmp4, (E, F) Shh, and (G, H) Six3. Anterior/posterior patterning of the ventral diencephalon is not altered in Wnt1-Cre;Kif3afl/fl mutants. Telencephalon (tel), Rathke’s pouch (rp); Scale bar: 175 µm.

NIHMS910725-supplement-4.jpg (1.4MB, jpg)
5. Supplemental Figure 5. Cell proliferation and cell death in the ventral neuroectoderm of Wnt1-Cre;Kif3afl/fl mutants is not altered.

Frontal section of (A) wild-type and (B) Wnt1-Cre;Kif3afl/fl embryos immunostained for PHH3. (C) Quantification of the number of PHH3+ cells normalized over neuroectodermal length indicated that there was no significant change in the amount of proliferation. Frontal section of (D) wild-type and (E) Wnt1-Cre;Kif3afl/fl embryos with TUNEL staining. (C) Quantification of the number of TUNEL+ cells normalized over neuroectodermal length indicated that there was no significant change in the amount of cell death. Scale bars: (A, B, D, E) 100 µm.

NIHMS910725-supplement-5.jpg (1.1MB, jpg)

RESOURCES