Table 1.
Small Viral RNAs Obtained by Deep Sequencing from SARS-CoV-Infected Lung Tissues
| svRNA | Sequence 5′→3′ | Genome position | Number of Reads |
|||
|---|---|---|---|---|---|---|
| SARS-CoV-wt |
SARS-CoV-ΔE |
|||||
| 2 dpi | 4 dpi | 2 dpi | 4 dpi | |||
| nsp3.1 | GAGGAAGAAGAGGACGAT | 3,052–3,069 nt | 386 | 44 | 121 | 23 |
| nsp3.2 | GAGGAAGAAGAAGAGGAAGACT | 3,184–3,205 nt | 832 | 80 | 169 | 33 |
| N | AGGAACTGGCCCAGAAGCTTC | 28,461–28,481 nt | 706 | 30 | 136 | 17 |
| neg | AATCAGTTTACTGGTTATTTAA | 3,274–3,295 nt | 0 | 0 | 0 | 0 |
| svRNAs | 13.6% | 12.09% | 22.19% | 22.48% | ||
The average number from three biological replicates of all three svRNA reads expressed as the percentage of total reads aligning to the viral genome is indicated in the bottom row for each experimental condition.