Table 2.
Larix primer pairs with the corresponding annealing temperature (Ta), product size, the possible single-nucleotide polymorphism (SNP) variants and ecoPCR specificity indicated by possible matches (MF: mismatches in forward primer; MR: mismatches in reverse primer; and L: length of DNA target sequence).
| Primer Name | Sequence (5’–3’) | Ta (°C) | Product Size (nt) | SNP Variants | ecoPCR Specificity |
|---|---|---|---|---|---|
| cp77444F cp77444R |
GGAAGGAAGGCGGAATGAATAG TCCATTACAGTACTTCCCTTCAG |
58 | 37 | A/C | Larix decidua |
| (MF = 0, MR = 0, L = 37) | |||||
| Larix occidentalis | |||||
| (MF = 0, MR = 0, L = 38) | |||||
| Pseudotsuga sinensis | |||||
| (MF = 2, MR = 1, L = 37) | |||||
| cp103595F cp103595R |
GATGGATCACTTTCTGTCAAGGT GTATAGACAATGTTTCTCTGGCG |
58 | 54 | T/C | Larix decidua |
| (MF = 0, MR = 0, L = 54) | |||||
| Pseudotsuga menziesii | |||||
| (MF = 0, MR = 2, L = 54) | |||||
| Pseudotsuga sinensis | |||||
| (MF = 0, MR = 2, L = 54) | |||||
| Picea morrisonicola | |||||
| (MF = 0, MR = 3, L = 54) | |||||
| Picea abies | |||||
| (MF = 0, MR = 3, L = 54) | |||||
| Picea jezoensis | |||||
| (MF = 0, MR = 3, L = 54) | |||||
| Keteleeria | |||||
| (MF = 0, MR = 3, L = 54) | |||||
| Cedrus deodara | |||||
| (MF = 0, MR = 3, L = 54) | |||||
| Keteleeria davidiana | |||||
| (MF = 0, MR = 3, L =54) | |||||
| Abies koreana | |||||
| (MF = 0, MR = 3, L = 54) | |||||
| Abies nephrolepis | |||||
| (MF = 0, MR = 3, L = 54) | |||||
| Picea glauca | |||||
| (MF = 0, MR = 3, L = 54) | |||||
| Tsuga chinensis | |||||
| (MF = 0, MR = 3, L = 54) | |||||
| Pseudolarix amabilis | |||||
| (MF = 0, MR = 3, L = 54) |