Table 2.

Biological RNA sequences used in this study.

Identifier	Organism	RNA type	Sequence	Secondary structure
AF357483	Mus musculus	snmRNA	AAGCAAUUGUUUUACUUACAGUCUGGAGAA	...(((((((.......))))).)).....
Z71666	Saccharomyces cerevisiae	snoRNA	AGGCGUGUAACAUUUAUUGGUUACAACAUG	.....((((((........)))))).....
AB055777	Homo sapiens	noncoding transcript	CUCUUUUACCAAGGACCCGCCAACAUGGGC	.(((((....)))))((((......)))).
AF036740	Schistosoma mansoni	ribozyme	AUCCAGCUCACGAGUCCCAAAUAGGACGAAACGCGUCCUCCAU	......................((((((.....))))))....

Columns from left to right: 'Identifier': the fRNAdb database identifiers ⁷⁴ for the four sequences considered here; 'Organism': the organism in which the RNA sequence was identified; 'RNA type': functional classification of the RNA sequence; 'Sequence': the sequence of the RNA; 'Secondary structure': the secondary structure of the RNA sequence. We computed secondary structures using the fold function from the ViennaRNA package ⁷⁵.