Table 1.
RT-qPCR gene, primer and target/amplicon information for the 13 investigated candidate references genes.
| Gene symbol | Gene name (Homo sapiens) | Gene function | Accession Number (NCBI GeneBank) | Chrom-osoma location (length) | 5´-forward primer-3´ (length/Tm/%GC/max. ∆G Hairpin &Self-Dimer/Self-Comp./Self-3’-Comp.) | 5´-reverse primer-3´ (length/Tm/%GC/max. ∆G Hairpin &Self-Dimer/Self-Comp./Self-3’-Comp.) | Primer Location (max. ∆G Cross-Dimer) | Amplicon (length, %GC, Tm, SSAT) | Amplicon location (bp of Start/Stop) | Intron-flanking (length) | In silico qPCR specifity | Variants targeted (Tran-script /Splice) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| GAPDH | glyceraldehyde-3-phosphate dehydrogenase | enzyme in glycolysis and gluconeo-genesis | NM_002046.5 | 12p13.31 (1421 bp) | TGCCCTCAACGACCACTTTG (20 bp/59.4 °C/55.0%/−0.7/3/2) | CCACCACCCTGTTGCTGTAG (20 bp/61.4 °C/60.0%/0.0/4/2) | exon 8/9 (−2.4) | 74 bp, 50.0%, 84.0 °C, no SSAT | 1091/1164 | Yes (104 bp) | Yes (BLAST /UCSC) | Yes |
| PPIB | peptidylprolyl isomerase A (cyclophilin B) | ER cyclosporine-binding protein | NM_000942.4 | 15q21-q22 (1045 bp) | TTCCATCGTGTAATCAAGGACTTC (24 bp/59.3 °C/41.7%/−1.3/4/2) | GCTCACCGTAGATGCTCTTTC (21 bp/59.8 °C/52.4%/−0.7/4/0) | exon ¾ (−2.1) | 88 bp, 53.4%, 86.1 °C, no SSAT | 446/533 | Yes (3194 bp) | Yes (BLAST /UCSC) | Yes |
| YWHAZ | tyrosine 3-monoo-xygenase /tryptophan 5-monoo-xygenase activation protein, zeta | signal transduction, apoptotic pathways | NM_003406.3 | 8q23.1 (3003 bp) | AGGAGATTACTACCGTTACTTGGC(24 bp/61.0 °C/46%/0.0/4/2) | AGCTTCTTGGTATGCTTGTTGTG (23 bp/58.9 °C/43%/−3.0/4/0) | exon 8/9 (−2.2) | 91 bp, 47.3%, 84.0 °C, no SSAT | 504/572 | Yes (617 bp) | Yes (BLAST /UCSC) | Yes |
| POLR2A | polymerase (RNA) II (DNA directed) polypeptide A, 220 kDa | transcription of DNA into mRNA | NM_000937.4 | 17p13.1 (6738 bp) | TCGCTTACTGTCTTCCTGTTGG (22 bp/60.3 °C/50.0%/0.0/3/0) | TGTGTTGGCAGTCACCTTCC (20 bp/59.4 °C/55.0%/−1.3/3./ 3) | exon 21/22 (−2.5) | 108 bp, 53.7%, 87.8 °C, no SSAT | 3798/3905 | Yes (468 bp) | Yes (BLAST /UCSC) | Yes |
| TBP | TATA-box-binding protein | general transcription factor | NM_003194.4 | 6q27 (1921 bp) | CGGCTGTTTAACTTCGCTTCC (21bp/59.8 °C/52.4%/−0.8/5/0) | TGGGTTATCTTCACACGCCAAG (22 bp/60.3 °C/50.0%/−1.5/3/2) | exon ½ (−2.4) | 86 bp, 51.2%, 85.6 °C, no SSAT | 79/164 | Yes (2418 bp) | Yes (BLAST /UCSC) | Yes |
| RPL22 | ribosomal protein L22 | translation of mRNA in protein | NM_000983.3 | 1p36.31 (2099 bp) | TGATTGCACCCACCCTGTAG (20 bp/59.4 °C/55.0%/−3.4/4/2) | GGTTCCCAGCTTTTCCGTTC (20 bp/59.4 °C/55.0%/−3.0/4/0) | exon 2/3 (−1.5) | 98 bp, 44.9%, 83.8 °C, no SSAT | 115/212 | Yes (4597 bp) | Yes (BLAST /UCSC) | Yes |
| EEF1A1 | eukaryotic translation elongation factor 1 alpha 1 | enzymatic delivery of aminoacyl tRNAs to ribosome | NM_001402.5 | 6q14.1 (3528 bp) | CCTGCCTCTCCAGGATGTCTAC (22 bp/64.0 °C/59.1%/−3.0/5/2) | GGAGCAAAGGTGACCACCATAC (22 bp/62.1 °C/54.6%/−3.2/6/2) | exon 5/6 (−2.9) | 105 bp, 52.4%, 86.5 °C, no SSAT | 804/908 | Yes (87 bp) | Yes (BLAST /UCSC) | Yes |
| RPLP0 | ribosomal protein, large, P0 | translation of mRNA in protein | NM_001002.3 | 12q24.2 (1229 bp) | GAAACTCTGCATTCTCGCTTCC(22 bp/60.3 °C/50.0%/−3.4/4/0) | GACTCGTTTGTACCCGTTGATG (22 bp/60.3 °C/50.0%/−2.0/4/0) | exon 6/7 (−1.8) | 120 bp, 50.8%, 86.5 °C, no SSAT | 803/921 | Yes (1091 bp) | Yes (BLAST /UCSC) | Yes |
| RNA18S5 | 18S ribosomal 5 | ribosomal RNA, translation of mRNA in protein | NR_003286.2 | 22p12 (1869bp) | AACTGCGAATGGCTCATTAAATCw (23 bp/57.1 °C/39.1%/−1.7/6/3) | GCCCGTCGGCATGTATTAG(19 bp/58.8 °C/57.9%/−2.4/5/1) | (−2.4) | 103 bp, 46.6%, 83.7 °C, no SSAT | 84/186 | No (rRNA) | No(RNA45S5 also targeted) | — |
| UBC | ubiquitin C | maintains ubiquitin levels under stress (protein removal) | NM_021009.6 | 12q24.3 (2594 bp) | No specific primer pair meeting all criteria could be designed. | — | — | — | — | — | — | |
| GUSB | glucuro-nidase, beta | breakdown of glycosamin-oglycans in lysosomes | NM_000181.3 | 7q21.11 (2321 bp) | No specific primer pair meeting all criteria could be designed. | — | — | — | — | — | — | |
| ACTB | actin, beta | cytoskeletal structural protein | NM_001101.3 | 7p22 (1852bp) | No specific primer pair meeting all criteria could be designed. | — | — | — | — | — | — | |
| TUBB | tubulin, beta class I | cytoskeletal structural protein | NM_001293212.1 | 6p21.33 (2772 bp) | No specific primer pair meeting all criteria could be designed. | — | — | — | — | — | — |
ER = endoplasmic reticulum; Tm = melting temperature of primer/specific qPCR product (amplicon); %GC = guanine/cytosine content; bp = base pairs; Comp. = Complementarity; SSAT = secondary structure at annealing temperature.