Skip to main content
. Author manuscript; available in PMC: 2018 Oct 1.
Published in final edited form as: Stem Cell Res. 2017 Sep 1;24:102–105. doi: 10.1016/j.scr.2017.08.020

Table 2.

Reagents details

Antibodies used for immunocytochemistry/flow-cytometry
Antibody Dilution Company Cat # and RRID
Pluripotency Marker Rabbit mAb anti-OCT4A 1:400 StemLight kit, Cell Signaling Technology, Cat# 9092
Pluripotency Marker Rabbit mAb anti-SOX2 1:400 StemLight kit, Cell Signaling Technology, Cat# 9092
Pluripotency Marker Rabbit mAb anti-NANOG 1:400 StemLight kit, Cell Signaling Technology, Cat# 9092
Pluripotency Marker Rabbit mAb anti-LIN28A 1:400 StemLight kit, Cell Signaling Technology, Cat# 9092
Pluripotency Marker PE-conjugated mouse mAb anti-SSEA4 1:20 ThermoFisher, Cat# 12-8843-41
Secondary antibody Goat anti-Rabbit IgG Alexa Fluor Plus 488 1:500 ThermoFisher, Cat# A32731
Isotype control antibody Mouse IgG3 Isotype Control, PE 1:20 ThermoFisher, Cat# 12-4742-42
Primers
Target Forward/Reverse primer (5′-3′)
Mycoplasma detection Mycoplasma 16S rRNA GGCGAATGGGTGAGTAACACG
CGGATAACGCTTGCGACCTATG
POGLUT1 mutation fragment amplification A 506-bp amplicon containing mutation region TGACCTGAACAACATACCCTTCA
GCTAATGCTGGTTCATGGAACTT
POGLUT1 amplicon sequencing A 20-bp region located 125-bp upstream of the mutation within the amplicon GTCCTAGTCCTGCTCACCTT