Table 3. Transcription-factor binding-site predictions.
Transcription-factor binding site (TFBS) predictions in Hmu, Yfu, Yfe and Yiu promoters. PMW (species) indicates the transcription factor that was detected and the species from which the TFBS sequence was determined. Start and end positions indicate the positions in the promoter containing the TFBS. Strand indicates which strand contains the TFBS. Score indicates a similarity score between the promoter and the TFBS position weight matrix. Sequence indicates the nucleotides in the promoter that correspond to the TFBS.
| PWM (species) | Start position | End position | Strand | Score | Sequence | |
|---|---|---|---|---|---|---|
| Hmu | OxyR (SELEX) | E. coli (strain K12) | 2 | 47 | − | 13.62 | ACAAAATGGATTACCGGATGAATGATTTCAGACTAACTTTTTTTCA |
| CspA | E. coli (strain K12) | 95 | 99 | + | 10 | CCAAT | |
| GcvA | E. coli (strain K12) | 102 | 106 | − | 10 | CTAAT | |
| Yfu | OxyR (SELEX) | E. coli (strain K12) | 190 | 235 | + | 13.44 | GAAATATTCAGATAACAATGATAATCATTTTTATTACCATAATTCG |
| OxyR (SELEX) | E. coli (strain K12) | 39 | 84 | − | 13.17 | ATTATATGAAGAGTACCGGCTTTAACGGCATTTTCCTGTTTGTTCA | |
| CspA | E. coli (strain K12) | 104 | 108 | + | 10 | CCAAT | |
| GcvA | E. coli (strain K12) | 175 | 179 | − | 10 | CTAAT | |
| Yfe | Fur (18-mer) | E. coli (strain K12) | 170 | 187 | − | 28.77 | AAAATGATTATCAATACC |
| OmpR (C box)| E. coli (strain K12) | 28 | 37 | + | 12.14 | TGTAGCATAT | |
| CpxR | E. coli (strain K12) | 113 | 128 | + | 12.13 | AGTAACTATTGGTAAG | |
| CspA | E. coli (strain K12) | 120 | 124 | − | 10 | CCAAT | |
| GcvA | E. coli (strain K12) | 165 | 169 | + | 10 | CTAAT | |
| Ysu | LexA | E. coli (strain K12) | 33 | 48 | + | 10.45 | TTGGCAAAAGATACAG |
| Yiu | OxyR (SELEX) | E. coli (strain K12) | 27 | 72 | − | 13.61 | TTGATAAGTATTATCATTTGCTTTATTGTTAGCGCCATCTTATGGG |
| OxyR (SELEX) | E. coli (strain K12) | 225 | 270 | + | 13.54 | TTTATAGGCACTAAAGAAGGGCGATAGCGTTATCGCCCTTTCATCC | |
| OxyR (SELEX) | E. coli (strain K12) | 152 | 197 | − | 13.4 | ACGAAATGTGCTGGTATTGGCGCATTCTATCCGTGAACATCAGGCT | |
| CpxR | E. coli (strain K12) | 96 | 111 | + | 12.66 | CGTAACTTTTTGTAAG | |
| CpxR | E. coli (strain K12) | 86 | 101 | + | 12.26 | AGTAATTGGACGTAAC | |
| LexA | E. coli (strain K12) | 199 | 214 | − | 10.47 | CTGACGCCAATACCAG | |
| FhlA | E. coli (strain K12) | 191 | 197 | + | 10.24 | ATTTCGT | |
| CspA | E. coli (strain K12) | 204 | 208 | − | 10 | CCAAT | |
| CspA | E. coli (strain K12) | 178 | 182 | + | 10 | CCAAT | |
| CspA | E. coli (strain K12) | 130 | 134 | − | 10 | CCAAT | |
| GcvA | E. coli (strain K12) | 221 | 225 | + | 10 | CTAAT | |
| GcvA | E. coli (strain K12) | 145 | 149 | + | 10 | CTAAT |