. Author manuscript; available in PMC: 2018 Dec 1.

Published in final edited form as: Mol Microbiol. 2017 Oct 26;106(5):832–846. doi: 10.1111/mmi.13849

Table 1.

Constructs	Genotype/description/sequence	Source
S. pneumoniae strains
R6
R800	R6 rpsL1; Str^R	Sung et al., 2001
ftsZ-kan-rpsL	R800; ftsZ::ftsZ-kan-rpsL; Kan^R	Fleurie et al., 2014a
ftsZ-mKate	R800 ftsZ::ftsZ-mKate; Str^R	This work
R800 P_Zn-adr	R800 bgaA::P_czcD –adr (pJBadr); Str^R, Tet^R	This work
R800 P_Zn	R800 bgaA::P_czcD (pADG02); Str^R, Tet^R	This work
R6 ΔlytA	R6 lytA::cat; Cat^R	Pagliero et al., 2008
ΔlytA	R800 lytA::cat; Str^R Cat^R	This work
Δadr-kan-rpsL	R800 adr::kan-rpsL; Kan^R	This work
Δadr	R800 adr::Δadr; Str^R	This work
Δadr P_Zn-adr	R800 adr::Δadr bgaA::P_czcD –adr (pJBadr); Str^R, Tet^R
Δadr P_Zn	R800 adr::Δadr bgaA::P_czcD (pADG02); Str^R, Tet^R
ΔpgdA-kan-rpsL	R800 pgdA::kan-rpsL, Kan^R	This work
Δadr ΔlytA	R800 adr::Δadr lytA::cat; Str^R, Cat^R	This work
ΔpgdA ΔlytA	R800 pgdA::kan-rpsl lytA::cat; Kan^R, Cat^R	This work
adr-sfGFPop	R800 adr::adr-sfGFPop; Str^R	This work
Δadr ftsZ-kan-rpsL	R800 adr::Δadr ftsZ::ftsZ-kan-rpsL; Kan^R	This work
Δadr ftsZ-mKate	R800 adr::Δadr; ftsZ::ftsZ-mKate; Str^R	This work
Δadr-kan-rpsL ftsZ-mKate	R800 adr::kan-rpsL; ftsZ::ftsZ-mKate; Kan^R	This work
adr-sfGFPop ftsZ-mKate	R800 adr::adr-sfGFPop ftsZ::ftsZ-mKate; Str^R	This work
ΔmapZ	R800 mapZ:: ΔmapZ; Str^R	Fleurie et al., 2014a
ΔmapZ Δadr-kan-rpsL	R800 mapZ:: ΔmapZ adr::kan-rpsL;Kan^R	This work
ΔmapZ adr-sfGFPop ftsZ-mKate	R800 mapZ:: ΔmapZ adr::adr-sfGFPop ftsZ::ftsZ-mKate; Str^R	This work
ΔgpsB	R800 gpsB:: gpsB; Str^R	Fleurie et al., 2014b
ΔgpsB Δadr-kan-rpsL	R800 gpsB:: gpsB adr::kan-rpsL;Kan^R	This work
ΔgpsB adr-sfGFPop ftsZ-mKate	R800 gpsB:: gpsB adr::adr-sfGFPop ftsZ::ftsZ-mKate; Str^R	This work
Δpbp1a	R6, Cat^R	Paik et al., 1999
Δpbp1a rpsL1	R6 rpsL1 pbp1a::cat; Cat^R, Str^R	This work
Δpbp1a Δadr-kan-rpsL	R6 rpsL1 pbp1a::cat adr::kan-rpsL; Cat^R, Kan^R	This work
Δpbp1a adr-sfGFPop	R6 rpsL1 pbp1a::cat adr::adr-sfGFPop; Cat^R, Str^R	This work
Δpbp1b	R6, Cat^R	Paik et al., 1999
Δpbp1b rpsL1	R6 rpsL1 pbp1b::cat; Cat^R, Str^R	This work
Δpbp1b Δadr-kan-rpsL	R6 rpsL1 pbp1b::cat adr::kan-rpsL; Cat^R, Kan^R	This work
Δpbp1b adr-sfGFPop	R6 rpsL1 pbp1b::cat adr::adr-sfGFPop; Cat^R, Str^R	This work
Δpbp2a	R6, Cat^R	Paik et al., 1999
Δpbp2a rpsL1	R6 rpsL1 pbp2a::cat; Cat^R, Str^R	This work
Δpbp2a Δadr-kan-rpsL	R6 rpsL1 pbp2a::cat adr::kan-rpsL; Cat^R, Kan^R	This work
Δpbp2a adr-sfGFPop	R6 rpsL1 pbp2a::cat adr::adr-sfGFPop; Cat^R, Str^R	This work
Δpbp3	R6, dacAC-ter::ery; Ery^R	Schuster et al., 1990
Δpbp3 rpsL1	R6 rpsL1, dacAC-ter::ery; Ery^R	This work
Δpbp3 Δadr-kan-rpsL	R6 rpsL1 dacAC-ter::ery adr::kan-rpsL; Ery^R, Kan^R	This work
Δpbp3 adr-sfGFPop	R6 rpsL1 dacAC-ter::ery adr::adr-sfGFPop; Ery^R, Str^R	This work
ΔspxB	R6 spxB::kan; Kan^R	This work
ΔspxB ΔlytA	R6 spxB::kan adr::cat; Kan^R, Cat^R	This work
Plasmids
pJWV25	[bgaA::P_Zn-gfp+], Amp^R, Tet^R	Eberhardt et al., 2009
pCM38	[bgaA::P_Zn-gfp+], Amp^R, Tet^R, AgeI	This work
pCM83	[bgaA::P_Zn-sfgfpopt], Amp^R, Tet^R, AgeI	This work
pADG0	[bgaA::P_Zn-sfgfpopt], Amp^R, Tet^R, AgeI, BssHII, BsiWI	This work
pADG02	[bgaA::P_Zn], Amp^R, Tet^R, AgeI, BssHII, BsiWI	This work
pJBadr	[bgaA::P_Zn-adr], Amp^R, Tet^R, AgeI, BssHII, BsiWI	This work
pET28-His-LytA	pET28a::his-lytA Kan^R, Cm^R	Philippe et al., 2015
pET28-His-LytAE87Q	pET28a::his-lytAE87A Kan^R, Cm^R	This work
Oligonucleotides
FORoJB1	ggctatgggcttgatgagttc To amplify lytA::cat cassette	This work
FORoJB2	gcatcaaggtatccatcattcc To amplify lytA::cat cassette	This work
FORoJB3	actgtctttcccagcttcgg amplification upstream of the adr gene	This work
REVoJB6	acctgccaagttacctgtcg amplification downstream of the adr gene	This work
REVoJB7	ttagatccggatccctcgagttttgatttaaccggcttgtcttgag Construction of adr-sfGFPop	This work
FORoJB8	atggatgaattgtacaaataactc aag aca agccggttaaatc Construction of adr-sfGFPop	This work
FORoJB9	ctcgagggatccggatctaaaggtgaagagttgttt sfGFPop amplification	This work
REVoJB10	tttgtacaattcatccatacc sfGFPop amplification	This work
REVoJB35	taaccggcttgtcttacgagtttattcttcctttcattgtac Construction of adr::Δadr	This work
FORoJB36	gaagaataaactcgtaagacaagccggttaaatcaaaataac Construction of adr::Δadr	This work
FORoJB57	cgcgcgcgcatgcgcattaaatggttttccttgattaggattatag Construction of pJBadr	This work
REVoJB58	gcgcgtacgttattttgatttaaccggcttgtcttgagctgt Construction of pJBadr	This work
FORoMJ129	gatagcgccagttccgatga Construction of pgdA::kan-rpsl	This work
FORoMJ62	ggttgaatggctttcaatcagttgaaccgctgcataggtctcagc insertion of E87Q mutation in the pET28-His-LytA plasmid	This work
REVoMJ63	gctgagacctatgcagcggttcaactgattgaaagccattcaacc insertion of E87Q mutation in the pET28-His-LytA plasmid	This work
FORoMJ130	ttgattgaccgcaggaacga Construction of pgdA::kan-rpsl	This work
FORoMJ142	cattaaaaatcaaacggatctgccacgtcctagtctac Construction of pgdA::kan-rpsl	This work
FORoMJ143	aggggcccaggtctcagctgtactatagtcgtgatg Construction of pgdA::kan-rpsl	This work
FORoMJ42	cctatccgcctcttgcaagc amplification upstream of the ftsZ gene for ftsZ-kan-rpsl and ftsZ-mKate amplification	Jacq et al., 2015
FORoMJ47	cttttaaagacatggttctctcctac amplification downstream of the ftsZ gene for ftsZ-kan-rpsl and ftsZ-mKate amplification	Jacq et al., 2015
P1	ccgtttgatttttaatggataatg Kan-rpsl amplification	This work
P2	agagacctgggcccctttcc Kan-rpsl amplification	This work
F1rpsL1	ggtggttgtatttctgttgttgggt Forward rpsL1 amplification	This work
R1rpsL1	aactgggacttggtagttagaaccac Reverse rpsL1 amplification	This work

Amp, ampicillin; Cm, chloramphenicol; Kan, kanamycin; Tet, tetracycline; Str, streptomycin.