Skip to main content
Applications in Plant Sciences logoLink to Applications in Plant Sciences
. 2017 Nov 14;5(11):apps.1700080. doi: 10.3732/apps.1700080

Characterization and development of EST-derived SSR markers in Sinowilsonia henryi (Hamamelidaceae)1

Zuo-Zhou Li 2, Hua Tian 2, Jin-Ju Zhang 2,3,4
PMCID: PMC5703181  PMID: 29188146

Abstract

Premise of the study:

Polymorphic microsatellite markers were developed to reveal the genetic diversity of extant populations and the mating system of Sinowilsonia henryi (Hamamelidaceae).

Methods and Results:

In this study, nuclear simple sequence repeat (SSR) markers were developed using the Illumina high-throughput sequencing technique (RNA-Seq). The de novo–assembled transcriptome generated a total of 64,694 unique sequences with an average length of 601 bp. A total of 2941 microsatellite loci were detected. Of the 121 tested loci, 13 loci were polymorphic and eight were monomorphic among 72 individuals representing three natural populations of the species. The number of alleles per locus ranged from one to four, and the observed and expected heterozygosity at population level were 0.00–1.00 and 0.10–0.66, respectively.

Conclusions:

The developed expressed sequence tag (EST)–SSRs will be useful for studying genetic diversity of S. henryi as well as assessing the mating system among Sinowilsonia species.

Keywords: Hamamelidaceae, microsatellite, RNA-Seq, Sinowilsonia henryi


The tree genus Sinowilsonia Hemsl. is a member of the Hamamelidaceae family and comprises only one species, S. henryi Hemsl. This species is narrowly distributed in the mountains of central China at an elevation of 600–1400 m (Zhang et al., 2003). Currently, the natural habitats of this species are severely deteriorated and fragmented, with population sizes ranging from as few as five individuals to approximately 50 flowering plants (Zhou et al., 2014). Thus, S. henryi has been listed as an endangered plant species in the China Plant Red Data Book (Fu and Jin, 1992).

Knowledge of genetic diversity and genetic structure of extant populations is essential to the formulation of effective conservation and management strategies for threatened species (Frankham et al., 2002). Due to their codominance, hypervariability, and reliable scorability, microsatellite markers have been widely used in population genetic studies (Selkoe and Toonen, 2006). However, microsatellite markers for S. henryi are currently not available. High-throughput RNA sequencing (RNA-Seq) is one of the most useful next-generation sequencing techniques for identifying microsatellites. In the current study, we developed and characterized 21 expressed sequence tag–simple sequence repeat (EST-SSR) markers for S. henryi using RNA-Seq.

METHODS AND RESULTS

Total RNAs were isolated from young leaves using a cetyltrimethylammonium bromide (CTAB) procedure (Chang et al., 1993). The poly(A)+ RNA (mRNA) was purified with the RNA Clean-up Kit (Invitrogen, Carlsbad, California, USA) according to the manufacturer’s instructions. The purified RNA was subsequently fragmented into small pieces (200 bp) by the fragmentation buffer. Then, the cleaved RNA fragments were used for first-strand cDNA synthesis using reverse transcriptase (Invitrogen) with random hexamer primers. Subsequently, second-strand cDNA was synthesized using RNase H and DNA polymerase I (Tiangen, Beijing, China). Illumina paired-end sequencing adapters were then ligated to the ends of the 3′-adenylated cDNA fragments. The cDNA library was sequenced by Shanghai Haiyu Biotechnology Co. Ltd. on the Illumina HiSeq 2000 instrument (Illumina, San Diego, California, USA). Before assembly, raw reads were filtered to remove those containing adapter or low-quality reads (more than 20% of nucleotides with Q-value ≤ 10) and reads containing poly N (>10% ambiguous base calls). Transcriptome assembly was performed using the Trinity package (version 2013-02-25) with the default parameters (Grabherr et al., 2011).

A total of 28.7 million 300-bp, clean, paired-end reads were obtained. All clean reads are available from the National Center for Biotechnology Information (NCBI) Short Read Archive (SRA) database (Bioproject accession no. PRJNA394173). De novo assembly of clean reads resulted in 64,694 unique sequences with an average length of 601 bp and an N50 length of 999 bp. The MIcroSAtellite identification tool (MISA; Thiel et al., 2003) was used to screen for the presence of microsatellites. The parameters used to identify microsatellites were seven repeats for di-, five for tri- and tetra-, four for penta-, and three for hexanucleotide repeats. Subsequently, SSR primers were designed with minimum GC content of 40% and an expected product size ranging from 100 to 280 bp using Primer3 (Rozen and Skaletsky, 1999).

A total of 8892 SSRs containing repeats from di- to pentanucleotides were identified from 64,694 unique sequences. Dinucleotides were the most abundant repeat type (5232), followed by trinucleotides (2198), hexanucleotides (1035), pentanucleotides (259), and tetranucleotides (168). The dinucleotide repeat (AG/CT)n (3646) was followed by (AT/AT)n (1192), (AC/GT)n (384), and (CG/CG)n (11). Among the trinucleotide repeat motifs, the most frequent SSR motif was AAG/CTT (667), followed by AAT/ATT (314), AGC/CTG (301), and ATC/ATG (252) (Table 1). Of the 8892 identified SSRs, 2941 (33%) were suitable for designing locus-specific primers (Appendix S1 (752.5KB, xls) ).

Table 1.

Frequency of repeat motifs in nonredundant Sinowilsonia henryi ESTs.

No. of repeats
SSR motifs 3 4 5 6 7 8 9 10 11 12 >12 Total
AC/GT 106 86 71 64 54 3 0 384
AG/CT 717 802 1268 742 111 6 0 3646
AT/TA 283 275 325 248 59 1 1 1192
CG/GC 5 4 1 1 0 0 0 11
AAC/GTT 59 17 13 6 0 0 0 0 0 95
AAG/CTT 300 200 164 3 0 0 0 0 0 667
AAT/ATT 147 103 61 3 0 0 0 0 0 314
ACC/GGT 111 47 33 3 0 0 0 0 0 194
ACG/CGT 35 14 10 4 0 0 1 0 0 63
ACT/AGT 19 9 2 1 0 0 0 0 0 31
AGC/CTG 139 94 64 4 0 0 0 0 0 301
AGG/CCT 81 44 32 7 0 0 0 0 0 164
ATC/ATG 136 57 54 5 0 0 0 0 0 252
CCG/CGG 73 31 9 4 0 0 0 0 0 117
Tetra- 146 22 0 0 0 0 0 0 0 168
Penta- 252 7 0 0 0 0 0 0 0 0 259
Hexa- 844 191 0 0 0 0 0 0 0 0 0 1035

Note: — = number of repeats not calculated.

SSR loci with a minimum of 10 repeats for dinucleotides and seven for trinucleotides were selected for amplification. A total of 121 primer pairs were selected and used for further characterization. Eight individuals of S. henryi from Wuhan Botanical Garden, China, were collected to initially assess microsatellite polymorphism. Genomic DNA was isolated using the CTAB method (Doyle and Doyle, 1987). PCR reactions were performed in a 10-μL reaction mixture (final volume) containing approximately 50 ng of genomic DNA, 0.2 μM each of forward and reverse primer, 10 mM Tris-HCl (pH 8.4), 50 mM (NH4)2SO4, 1.5 mM MgCl2, 0.2 mM dNTPs, and 1 unit Taq polymerase (Fermentas, Vilnius, Lithuania). The PCR cycling program included 5 min of initial denaturation at 94°C; followed by 35 cycles of 50 s at 94°C, 50 s at 56–60°C depending on the primer pair (Table 2), and 1 min at 72°C; followed by a final 10-min extension step at 72°C. The PCR products were separated on a 6% polyacrylamide denaturing gel of high resolution with silver stain. A 25-bp marker ladder (Promega Corporation, Madison, Wisconsin, USA) was used to identify the alleles.

Table 2.

Characterization of 21 EST-SSR primers developed in Sinowilsonia henryi.

Locus Primer sequences (5′–3′) Repeat motif Allele size range (bp) Ta (°C) BLASTX top hit description E-value GenBank accession no.
SH01 F: TTTGACCCCGAAACAACAGC (CAT)7 209–213 58 MF503975
R: TGATACCGCTCAAGTCTCCC
SH02 F: CATCACCTTCTGCTGGAACG (TC)10 223–231 58 Hypothetical protein EUGRSUZ_G03166 3E-40 MF503976
R: ACCCCGGAGCATATATCAGC
SH03 F: CCACCTCGTTCTTCTCGTCT (ATC)7 210–213 58 Phospho-N-acetylmuramoyl-pentapeptide-transferase 2E-176 MF503977
R: CCTGACGGTAAAGAGAAACGC
SH04 F: GAGTCGGAGTCCCATTTTGC (TTC)7 258–275 60 NUDIX domain-containing protein 3E-165 MF503978
R: GTCTTCGAACATGAGGCGTC
SH05 F: TATGCTAGTGGTGGTGCTGT (GCA)7 195–202 58 MF503979
R: TAGTCGTCGGGCTCATCATC
SH06 F: ATTGAAGGCGTTTGGATCCG (GCC)7 148–158 58 MF503980
R: TGGCTTCCCTCTCGTCTTTT
SH07 F: TGACATGGAGGGTAGTGTGG (ATG)7 183–186 58 MF503981
R: TCACCTCTTCCATTGCCTTCT
SH08 F: GAAGCTGGAGTTTGTGACGG (GTT)8 214–225 58 MF503982
R: CTTCGGGGCCTATAGTTGGT
SH09 F: GGGGTGTTGTCCATTGATACAG (ACC)7 232–240 58 CBL-interacting protein kinase 07 0 MF503983
R: CCAGCAGTTGAAGTTCAGGAG
SH10 F: AACCAAATCAGGCTCGCTTT (AGC)7 225–239 59 Pre-mRNA-splicing factor SYF1 0 MF503984
R: CCGCTGCCAGATGAAATTGA
SH11 F: GGATTGCCATCATGCTGTTG (TC)10 209–215 58 Transmembrane protein 230 1E-61 MF503985
R: AGCAAATTTGGCCACTGGAG
SH12 F: GGCATCCACAGTGTTGCTAG (TC)10 154–156 58 MF503986
R: ACTTCTGGGGCCATTTCCTT
SH13 F: AAGGACGAGGATGAATGGGG (GCG)7 265–268 56 MF503987
R: CCCAATTCCCCTCGAGAAGT
SH14 F: TCACCATCATCACCACCTTCA (TTG)7 175 56 ABC transporter G family member 5-like 0 MF510515
R: AGGCTCATGGGTTTACAGCT
SH15 F: AGCAAGAGGACCAACACTCT (AAG)7 200 58 MF510516
R: TGCTGCTTTTACTTCCCCTC
SH16 F: CCAAGAGACCCCACCAACTA (GCT)7 256 56 MF510517
R: AGACGTTGCCTCAGTCTTGT
SH17 F: TGGCTTCCAACCTCCTCAAA (ACA)8 250 56 MF510518
R: GGTGGGGTGGAAGAAGAGAG
SH18 F: ACCCGCGATCATACTGACAA (CTG)7 165 56 DExH-box ATP-dependent RNA helicase 3E-35 MF510519
R: GGTCCGTCATCACTTCTCCT
SH19 F: GAGCAAACCCACAATCCAGA (GAG)7 200 58 MF510520
R: GCTGCCATGGTGAAGAAACA
SH20 F: GGGTGGGGAGAATAGGGAAG (CT)10 200 56 NADP-dependent malic enzyme 0 MF510521
R: AGAGGGAGAGAGGGTCACAA
SH21 F: CCATATCCGCCGCCAATAAG (GGT)7 275 58 Receptor-like protein 1, putative isoform 2 2E-35 MF510522
R: GCTCAATTTGCTACCTTTGAAG

Note: Ta = annealing temperature.

Of the 121 primer pairs tested, 21 successfully amplified the target fragments (Table 1); of these, 13 loci were polymorphic (SH01–SH13), while eight were detected as monomorphic (SH14–SH21; Table 2). The level of genetic variability was estimated by genotyping 72 individuals of S. henryi from three wild populations (Appendix 1). For each locus, the number of alleles (A), observed heterozygosity (Ho), and expected heterozygosity (He) were estimated using the program GENEPOP version 3.4 (Raymond and Rousset, 1995). Null alleles were detected at three loci (SH03, SH04, and SH07) using the program CERVUS 2.0 (Marshall et al., 1998). In the SNJ population, A ranged from one to three, He ranged from 0 to 0.60, and Ho ranged from 0 to 1.00. In the FS population, A ranged from one to three, He ranged from 0 to 0.66, and Ho ranged from 0 to 0.80. In the WD population, A ranged from one to four, He ranged from 0 to 0.63, and Ho ranged from 0 to 0.63. Three loci deviated from Hardy–Weinberg equilibrium after correction for multiple tests (Table 3). The observed departures from Hardy–Weinberg equilibrium may be due to null alleles. Significant linkage disequilibrium was observed in 10 pairs of loci before correction for multiple tests (P < 0.05). However, no loci were observed to be in linkage disequilibrium after correction for multiple tests (P < 0.0006). The sequences containing microsatellites were BLASTed against the NCBI nonredundant protein database using BLASTX with a threshold of E-value < 2.00E-5. Ten loci showed significant similarities to known proteins in the NCBI nonredundant protein database (Table 2).

Table 3.

Genetic diversity of 13 SSR loci in three populations of Sinowilsonia henryi.a

Locus SNJ (N = 15) FS (N = 25) WD (N = 32)
A He Ho A He Ho A He Ho
SH01 2 0.18 0.13 2 0.30 0.28 3 0.47 0.41
SH02 3 0.56 0.88 3 0.52 0.24 3 0.59 0.63
SH03 2 0.50 0.50 1 0.00 0.00*** 1 0.00 0.00***
SH04 2 0.31 0.38 3 0.63 0.32 3 0.48 0.38
SH05 3 0.60 1.00 3 0.25 0.28 2 0.42 0.41
SH06 3 0.51 0.75 3 0.37 0.32 3 0.41 0.38
SH07 1 0.00 0.00 2 0.42 0.20 1 0.00 0.00***
SH08 2 0.22 0.25 3 0.62 0.72 2 0.48 0.38
SH09 1 0.00 0.00*** 2 0.08 0.08 1 0.00 0.00***
SH10 2 0.38 0.25 3 0.63 0.56 3 0.63 0.59
SH11 3 0.53 0.75 3 0.66 0.80 4 0.36 0.38
SH12 2 0.50 0.75 2 0.34 0.36 2 0.49 0.47
SH13 2 0.22 0.25 2 0.39 0.36 2 0.44 0.34
Average 2.15 0.35 0.45 2.46 0.40 0.35 2.31 0.37 0.44

Note: A = number of alleles; He = expected heterozygosity; Ho = observed heterozygosity; N = number of individuals sampled.

a

Locality and voucher information are provided in Appendix 1.

***

Denotes significant departure from Hardy–Weinberg equilibrium after Bonferroni correction (P < 0.0006).

CONCLUSIONS

In the current study, a total of 2941 primer pairs were successfully designed based on transcriptome sequences. In total, 121 PCR primers of SSR loci were used for validation of amplification and polymorphism; of these, 13 revealed microsatellite polymorphism. To the best of our knowledge, this is the first study to develop microsatellites for S. henryi. These EST-derived SSRs could provide valuable tools for studying genetic diversity and assessing the mating system among Sinowilsonia species. In addition, because EST-derived SSRs may be associated with functional genes, the remaining untested 2820 SSRs and 21 loci developed in the current study may be useful for examining adaptive variation using genome scan methods.

Supplementary Material

Supplementary Material 1

Appendix 1.

List of vouchers of Sinowilsonia henryi used in this study.

Population code N Location Voucher no.a Geographic coordinates Altitude (m)
SNJ 15 Shennongjia Mountain, Hubei Province Q. G. Ye 1102 31°30′09″N, 110°24′03″E 1405
FS 25 Yangchashan, Fang County, Hubei Province Q. G. Ye 1108 31°53′01″N, 110°27′53″E 1201
WD 32 Wudang Mountain, Hubei Province Q. G. Ye 1109 32°40′59″N, 111°01′01″E 1035

Note: N = number of individuals sampled.

a

All vouchers are deposited at the Wuhan Botanical Garden Herbarium (HIB), Wuhan, Hubei Province, China.

LITERATURE CITED

  1. Chang S., Puryear J., Cairney J. 1993. A simple and efficient method for isolating RNA from pine trees. Plant Molecular Biology Reporter 11: 113–116. [Google Scholar]
  2. Doyle J. J., Doyle J. L. 1987. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochemical Bulletin 19: 11–15. [Google Scholar]
  3. Frankham R., Ballou J. D., Briscoe D. A. 2002. Introduction to conservation genetics. Cambridge University Press, Cambridge, United Kingdom. [Google Scholar]
  4. Fu L. K., Jin J. M. 1992. China plant red data book–rare and endangered plants. Science Press, Beijing, China. [Google Scholar]
  5. Grabherr M. G., Haas B. J., Yassour M., Levin J. Z., Thompson D. A., Amit I., Adiconis X., et al. 2011. Trinity: Reconstructing a full-length transcriptome without a genome from RNA-Seq data. Nature Biotechnology 29: 644–652. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Marshall T. C., Slate J., Kruuk L. E. B., Pemberton J. M. 1998. Statistical confidence for likelihood-based paternity inference in natural populations. Molecular Ecology 7: 639–655. [DOI] [PubMed] [Google Scholar]
  7. Raymond M., Rousset F. 1995. GENEPOP (Version 1.2): Population genetics software for exact tests and ecumenicism. Journal of Heredity 86: 248–249. [Google Scholar]
  8. Rozen S., Skaletsky H. 1999. Primer3 on the WWW for general users and for biologist programmers. In S. Misener and S. A. Krawetz [eds.], Methods in molecular biology, vol. 132: Bioinformatics: Methods and protocols, 365–386. Humana Press, Totowa, New Jersey, USA. [DOI] [PubMed] [Google Scholar]
  9. Selkoe K. A., Toonen R. J. 2006. Microsatellites for ecologists: A practical guide to using and evaluating microsatellite markers. Ecology Letters 9: 615–629. [DOI] [PubMed] [Google Scholar]
  10. Thiel T., Michalek W., Varshney R. K., Graner A. 2003. Exploiting EST databases for the development and characterization of gene-derived SSR-markers in barley (Hordeum vulgare L.). Theoretical and Applied Genetics 106: 411–422. [DOI] [PubMed] [Google Scholar]
  11. Zhang Z., Zhang H., Endress P. K. 2003. Flora of China, vol. 9. Science Press, Beijing, China, and Missouri Botanical Garden Press, St. Louis, Missouri, USA. [Google Scholar]
  12. Zhou T. H., Wu K. X., Qian Z. Q., Zhao G. F., Liu Z. L., Li S. 2014. Genetic diversity of the threatened Chinese endemic plant, Sinowilsonia henryi Hemsl. (Hamamelidaceae), revealed by inter-simple sequence repeat (ISSR) markers. Biochemical Systematics and Ecology 56: 171–177. [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Material 1

Articles from Applications in Plant Sciences are provided here courtesy of Wiley

RESOURCES