Table 1. Real-time PCR primers used for the detection of HERVs.
| Symbol | Accession | Region | Forward | Reverse | Size (bp) |
|---|---|---|---|---|---|
| HERV-WE1 | AF072506 | 290-463 | gggttccatggttctcttct | tggtgaaccacttccaagat | 174 |
| HERV-31 | NM001007253 | 1377-1562 | taaccagaaattgcctgagc | gaagaggcggttagtgtgaa | 186 |
| HERV-V1 | NM152473 | 1565-1757 | acacctctgaggagggattc | cccaggggaacagtagattt | 241 |
| HERV-H1 | BC015108 | 543-778 | caccccaacacttcaacact | tcacttaaggcaaggactgg | 236 |
| HERV-E1 | BC037342 | 1398-1562 | tacctactctggtgggtgga | ctttgccctcttctgtacca | 165 |
| HERV-K10 | FN806835.1 | 241-421 | ttgggctagtcaatgtcgtt | ctggcttattccctgaaaca | 181 |
| HERV-FRD1 | NM207582 | 504-698 | ctcattctcacgccttcact | taattccgcctctatgcttg | 195 |
| HERV-F (pol) | AB120695 | 98-229 | tacagcagcagcagcagttt | atctgggaaggaggaggaga | 132 |
| HERV-S (pol) | AB162179 | 81-264 | ccaacgtgttacctccactc | cagttcccgataatccactg | 184 |
| HERV-T (env) | AB266802 | 690-920 | cataatttgccggtcatagg | agttgatcccccagagtagg | 231 |
| HERV-L | EF141078 | 132-245 | agggctattatggtgggaag | catctttcaggtccttggtg | 123 |
The accession, region, sequence, polarity and product size for the primers used are reflected.