Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (Escherichia coli) | E. coli: DH5α | Invitrogen | Cat#11319019 | |
| Genetic reagent (Homo sapiens) | Rc/CMV cyclin E | Hinds et al. (1992) PMID: 1388095 | Addgene 8963 | |
| Genetic reagent (Homo sapiens) | pInducer20 | Meerbrey et al., 2011PMID: 21307310 | Addgene 44012 | |
| Genetic reagent (Homo sapiens) | ΔNRF | Dr. J. Bear | N/A | |
| Genetic reagent (Homo sapiens) | VSVG | Dr. J. Bear | N/A | |
| Genetic reagent (Homo sapiens) | pInducer20-Cyclin E1 | This Paper | N/A | see Materials and methods |
| Genetic reagent (Homo sapiens) | pDONR221 | Invitrogen | Cat#12536017 | |
| Genetic reagent (Homo sapiens) | pENTR221-Cyclin E1 | This Paper | N/A | |
| Genetic reagent (Homo sapiens) | PCR4-TOPO | Invitrogen | Cat# 450030 | |
| Genetic reagent (Homo sapiens) | pInducer20-blast | This Paper | N/A | see Materials and methods |
| Genetic reagent (Homo sapiens) | pInducer20-blast-Cdt1-HA | This Paper | N/A | see Materials and methods |
| Genetic reagent (Homo sapiens) | CLXSN-5myc-Cdc6-wt | This Paper | N/A | see Materials and methods |
| Genetic reagent (Homo sapiens) | CLXSN-5myc-Cdc6-mut | This Paper | N/A | see Materials and methods |
| Cell line (Homo sapiens) male | T98G | ATCC | Cat#CRL-1690 | |
| Cell line (Homo sapiens) female | RPE1-hTERT | ATCC | Cat#CRL-4000 | |
| Cell line (Homo sapiens) male | ARPE-19 | ATCC | Cat#CRL-2302 | |
| Cell line (Homo sapiens) female | H9 hESC (WA09) | WiCell | hPSCReg ID: WAe009-A | |
| Cell line (Homo sapiens) male | NPC | This Paper | N/A | see Materials and methods |
| Cell line (Homo sapiens) female | HEK293T | ATCC | Cat# CRL-3216 | |
| Cell line (Homo sapiens) male | ARPE-iPSC | This Paper | N/A | see Materials and methods |
| Antibody | Anti-Mcm2, mouse monoclonal (BM28) | BD Biosciences | Cat#610700;RRID: AB_2141952 | 1:10,000 (IB) 1:200 (FC) |
| Antibody | Anti-Mcm3, rabbit polyclonal | Bethyl Laboratories | Cat#A300-192A; RRID: AB_162726 | 1:10,000 (IB) 1:200 (FC) |
| Antibody | Anti-Cdt1, rabbit monoclonal (D10F11) (immunoblots) | Cell Signaling Technologies | Cat#8064S; RRID: AB_10896851 | 1:10,000 (IB) |
| Antibody | Anti-Cdt1, rabbit monoclonal (EPR17891) (flow cytometry) | Abcam | Cat#ab202067; RRID:AB_2651122 | 1:100 (FC) |
| Antibody | Anti-Cdc6, mouse monoclonal (180.2) | Santa Cruz Biotechnology | Cat#sc-9964; RRID: AB_627236 | 1:2000 (IB) |
| Antibody | Anti-Oct4, rabbit polyclonal (immunoblots) | Abcam | Cat#ab19857; RRID: AB_445175 | 1:4000 (IB) |
| Antibody | Anti-Oct4, mouse monoclonal (9B7) (microscopy) | Millipore | Cat#:MABD76; RRID: AB_10919170 | 1:1000 (IF) |
| Antibody | Anti-Cdx2, rabbit monoclonal (EPR2764Y) | Abcam | Cat#ab76541; RRID: AB_1523334 | 1:1000 (IF) |
| Antibody | Anti-Sox17, goat polyclonal | R and D Systems | Cat#AF1924; RRID: AB_355060 | 1:500 (IF) |
| Antibody | Anti-Cyclin E1, rabbit polyclonal | Santa Cruz Biotechnology | Cat#sc-198; RRID: AB_631346 | 1:2000 (IB) |
| Antibody | Anti-Orc1, rabbit polyclonal | Bethyl Laboratories | Cat#A301-892A; AB_1524103 | 1:1000 (IB) |
| Antibody | Anti-Orc6, rat monoclonal (3A4) | Santa Cruz Biotechnology | Cat#sc-32735; RRID: AB_670295 | 1:5000 (IB) |
| Antibody | Anti-geminin, rabbit polyclonal | Santa Cruz Biotechnology | Cat#sc-13015; RRID: AB_2263394 | 1:3000 (IB) |
| Antibody | Anti-Histone H3, rabbit monoclonal (D1H2) | Cell Signaling Technologies | Cat#4499S; RRID: AB_10544537 | 1:10,000 (IB) |
| Antibody | Anti-TRA-1–60, mouse monoclonal (cl.A) | Invitrogen | Cat#41–1000; RRID: AB_605376 | 1:5000 (IB) |
| Antibody | Anti-nestin, mouse monoclonal (10 C2) | Abcam | Cat#ab22035; RRID: AB_446723 | 1:10000 (IB) |
| Antibody | Anti-TRA-1–60 mouse (immunofluorescence) | Millipore/Chemicon | Cat# MAB4360; RRID: AB_2119183 | 1:400 (IF) |
| Antibody | Anti-TRA-81 mouse (immunofluorescence) | Millipore/Chemicon | Cat# MAB4381; RRID:AB_177638 | 1:400 (IF) |
| Antibody | Anti-SSEA-4 mouse (MC-813–70) (immunofluorescence) | Millipore/Chemicon | Cat# MAB4304; RRID:AB_177629 | 1:200 (IF) |
| antibody | Anti-SSEA3 rabbit (MC-631) (immunofluorescence) | Millipore/Chemicon | Cat# MAB4303; RRID:AB_177628 | 1:200 (IF) |
| Antibody | Anti-Oct3/4 goat polyclonal (immunofluorescence) | Abcam | Cat# ab27985; RRID:AB_776898 | 1:200 (IF) |
| Antibody | Anti-NANOG goat polyclonal (immunofluorescence) | Everest Biotech | Cat# EB068601; RRID:AB_2150379 | 1:200 (IF) |
| Antibody | Anti-p27 rabbit polyclonal | Santa Cruz Biotechnology | Cat#sc-528; RRID:AB_632129 | 1:2000 (IB) |
| Antibody | Anti-α-tubulin | Sigma Aldrich | Cat#9026 | 1:50000 (IB) |
| Antibody | Goat anti-Mouse-HRP | Jackson ImmunoResearch | Cat#115-035-146; RRID: AB_2307392 | 1:10000 (IB) |
| Antibody | Donkey anti-Rabbit-HRP | Jackson ImmunoResearch | Cat#711-035-152; RRID: AB_10015282 | 1:10000 (IB) |
| Antibody | Bovine anti-Goat-HRP | Jackson ImmunoResearch | Cat#805-035-180; RRID: AB_2340874 | 1:10000 (IB) |
| Antibody | Donkey anti-Rat-HRP | Jackson ImmunoResearch | Cat#712-035-153; RRID: AB_2340639 | 1:10000 (IB) |
| Antibody | Donkey anti-Goat-Alexa 594 | Jackson ImmunoResearch | Cat#705-585-147; RRID: AB_2340433 | 1:1000 (IF) |
| Antibody | Donkey anti-Rabbit-Alexa 488 | Life Technologies | Cat#A21206; RRID: AB_2535792 | 1:1000 (IF) (FC) |
| Antibody | Goat anti-Mouse-Alexa 594 | Life Technologies | Cat#A11032; RRID: AB_2535792 | 1:1000 (IF) |
| Antibody | Donkey anti-Rabbit-Alexa 647 | Jackson ImmunoResearch | Cat#711-605-152; RRID: AB_2492288 | 1:1000 (FC) |
| Antibody | Donkey anti-Mouse-Alexa 488 | Jackson ImmunoResearch | Cat#715-545-150; RRID: AB_2340845 | 1:1000 (FC) |
| Sequence-based reagent | siCdt1- CCUACGUCAAGCUGGACAATT | Nevis et al. (2009) PMCID: PMC2972510 | N/A | |
| Sequence-based reagent | siCdc6-2534- CACCAUGCUCAGCCAUUAAGGUAUU | Nevis et al. (2009) PMCID: PMC2972510 | N/A | |
| Sequence-based reagent | siCdc6-2144- UCUAGCCAAUGUGCUUGCAAGUGUA | Nevis et al. (2009) PMCID: PMC2972510 | N/A | |
| Sequence-based reagent | siControl (Luciferase)- CUUACGCUGAGUACUUCGA | Coleman et al. (2015) PMID: 26272819 | N/A | |
| Sequence-based reagent | siMCM3-2859 5’- augacuauugcaucuucauug | This paper | synthesized by invitrogen | |
| Sequence-based reagent | siMCM3-2936 5’- aacauaugacuucugaguacu | This paper | synthesized by invitrogen | |
| Sequence-based reagent | POU5F1-F: 5'-CCTGAAGCAGAAGAGGATCACC, | Eton Bioscience | ||
| Sequence-based reagent | POU5F1-R 5'-AAAGCGGCAGATGGTCGTTTGG, | Eton Bioscience | ||
| Sequence-based reagent | CDX2-F 5'-ACAGTCGCTACATCACCATCCG, | Eton Bioscience | ||
| Sequence-based reagent | CDX2-R 5'-CCTCTCCTTTGCTCTGCGGTTC, | Eton Bioscience | ||
| Sequence-based reagent | T-F 5'-CTTCAGCAAAGTCAAGCTCACC, | Eton Bioscience | ||
| Sequence-based reagent | T-R 5'-TGAACTGGGTCTCAGGGAAGCA, | Eton Bioscience | ||
| Sequence-based reagent | SOX17-F 5'-ACGCTTTCATGGTGTGGGCTAAG, | Eton Bioscience | ||
| Sequence-based reagent | SOX17-R 5'-GTCAGCGCCTTCCACGACTTG, | Eton Bioscience | ||
| Sequence-based reagent | CDT1-F 5'-GGAGGTCAGATTACCAGCTCAC, | Eton Bioscience | ||
| Sequence-based reagent | CDT1-R, 5'-TTGACGTGCTCCACCAGCTTCT, | Eton Bioscience | ||
| Sequence-based reagent | SOX2-F 5'-CTACAGCATGATGCAGGACCA, | Eton Bioscience | ||
| Sequence-based reagent | SOX2-R 5'-TCTGCGAGCTGGTCATGGAGT, | Eton Bioscience | ||
| Sequence-based reagent | PAX6-F 5'-AATCAGAGAAGACAGGCCA, | Eton Bioscience | ||
| Sequence-based reagent | PAX6-R 5'-GTGTAGGTATCATAACTC, | Eton Bioscience | ||
| Sequence-based reagent | ACTB-F 5'-CACCATTGGCAATGAGCGGTTC, | Eton Bioscience | ||
| Sequence-based reagent | ACTB-R 5'-AGGTCTTTGCGGATGTCCACGT | Eton Bioscience | ||
| Sequence-based reagent | CDC6-KEN-F: 5- ctccaccaaagcaaggcaaggcggccgcaggtccccctcactcacatacac | Eurofins | ||
| Sequence-based reagent | CDC6-KEN-R: 5- GTGTATGTGAGTGAGGGGGACCTGCGGCCGCCTTGCCTTGCTTTGGTGGAG | Eurofins | ||
| Sequence-based reagent | CDC6-DBOX-F: 5- aagccctgcctctcagccccgccaaacgtgccggcgatgacaacctatgcaa | Eurofins | ||
| Sequence-based reagent | CDC6-DBOX-R: 5- TTGCATAGGTTGTCATCGCCGGCACGTTTGGCGGGGCTGAGAGGCAGGGCTT | Eurofins | ||
| Sequence-based reagent | AgeI-rta3-F: 5- gctcggatctccaccccgtaccggtcctgcagtcgaattcac | Eurofins | ||
| Sequence-based reagent | AgeI-IRES-blast-R: 5-ACAAAGGCTTGGCCATGGTTTAAGCTTATCATCGTGTTTTTCA | Eurofins | ||
| Sequence-based reagent | Blast-F:5- tgaAaaacacgatgataagcttaaaccatggccaagcctttgt | Eurofins | ||
| Sequence-based reagent | Blast-AgeI-Ind-R: 5-GTTCAATCATGGTGGACCGG CTATTAGCCCTCCCACACATAACCA | Eurofins | ||
| Sequence-based reagent | BP-cycE-F 5'GGGGACAAGTTTGTACAAAAAAGCAGGCTACCATGAAGGAGGACGGCGGC | Eurofins | ||
| Sequence-based reagent | BP-cycE-R 5'GGGGACCACTTTGTACAAGAAAGCTGGGTTCACGCCATTTCCGGCCCGCT | Eurofins | ||
| Software, algorithm | MATLAB | MathWorks | https://www.mathworks.com/ | |
| Software, algorithm | GraphPad Prism 7 | GraphPad Software | https://www.graphpad.com/scientific-software/prism/ | |
| Software, algorithm | NIS-Elements Advanced Research Software | Nikon | https://www.nikoninstruments.com/Products/Software/NIS-Elements-Advanced-Research | |
| Software, algorithm | CellProfiler | Carpenter et al., 2006 PMC1794559 | http://cellprofiler.org/ | |
| Software, algorithm | FCS Express 6 | De Novo Software | https://www.denovosoftware.com/ | |
| Software, algorithm | FCSExtract Utility | Earl F Glynn | http://research.stowers.org/mcm/efg/ScientificSoftware/Utility/FCSExtract/index.htm | |
| Software, algorithm | QUMA | RIKEN | http://quma.cdb.riken.jp | |
| Software, algorithm | Adobe Photoshop CS6 | Adobe | http://www.adobe.com/products/photoshop.html | |
| Commercial assay or kit | CytoTune-iPS 2.0 Sendai reprogramming kit | Invitrogen | Cat#A16517 | |
| Commercial assay or kit | DNeasy Blood and Tissue kit | Qiagen | Cat#69504 | |
| Commercial assay or kit | RNeasy Mini kit | Qiagen | Cat#74104 | |
| Commercial assay or kit | Epitect Bisulfite kit | Qiagen | Cat#59104 | |
| Commercial assay or kit | Norgen Biotek’s Total RNA Purification Kit | Norgen Biotek | Cat#37500 | |
| Commercial assay or kit | Applied Biosystem’s High-Capacity RNA-to-cDNA | Applied Biosystem | Cat#4387406 | |
| Commercial assay or kit | Alkaline Phosphatase Detection Kit | Millipore | Cat# SCR004 | |
| Commercial assay or kit | QIAquick Gel Extraction kit | Qiagen | Cat# 28704 | |
| Chemical compound, drug | DAPI | Life Technologies | Cat#D1306 | |
| Chemical compound, drug | EdU | Santa Cruz Biotechnology | Cat#sc-284628 | |
| Chemical compound, drug | Ponceau S | Sigma Aldrich | Cat#P7170-1L | |
| Peptide, recombinant protein | BMP4 Protein | R and D Systems | Cat#314 BP-010 | |
| Peptide, recombinant protein | Activin A Protein | R and D Systems | Cat#338-AC-010 | |
| Chemical compound, drug | Y-27632 2HCl | Selleck Chemicals | Cat#S1049 | |
| Chemical compound, drug | CHIR-99021 | Selleck Chemicals | Cat#S2924 | |
| Chemical compound, drug | mTESR1 | Stem Cell Technologies | Cat#05850 | |
| Chemical compound, drug | STEMdiff Neural Induction Medium | Stem Cell Technologies | Cat#05835 | |
| Chemical compound, drug | STEMdiff Neural Progenitor Medium | Stem Cell Technologies | Cat#05833 | |
| Chemical compound, drug | Essential 8 Medium | Life Technologies | Cat#A1517001 | |
| Chemical compound, drug | Doxycycline | CalBiochem | Cat#324385 | |
| Chemical compound, drug | Alexa 647-azide | Life Technologies | Cat#A10277 | |
| Chemical compound, drug | Alexa 488-azide | Life Technologies | Cat#A10266 | |
| Chemical compound, drug | Hydroxyurea | Alfa Aesar | Cat#A10831 | |
| Chemical compound, drug | Corning Matrigel GFR Membrane Matrix | Corning | Cat#CB-40230 | |
| Chemical compound, drug | Poly-L-Ornithine | Sigma Aldrich | Cat#P4957-50ML | |
| Chemical compound, drug | Laminin | Sigma Aldrich | Cat#L2020-1MG | |
| Chemical compound, drug | ReLesR | Stem Cell Technologies | Cat#05872 |