Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Genetic reagent (D. melanogaster) |
ETHRB-Gal4 (ETHRBMI00949-Gal4) |
Diao et al. (2016)
(doi: 10.1534/genetics.115.182121) |
N/A | |
| Genetic reagent (D. melanogaster) |
ETHRA-Gal4 (ETHRAMI00949-Gal4) |
Diao et al. (2016)
(doi: 10.1534/genetics.115.182121) |
N/A | |
| Genetic reagent (D. melanogaster) |
ETHRA-p65AD (ETHRAMI00949-p65AD) |
Diao et al. (2016)
(doi: 10.1534/genetics.115.182121) |
N/A | |
| Genetic reagent (D. melanogaster) |
ETHRB-p65AD | This paper | N/A | Split Gal4 hemidriver |
| Genetic reagent (D. melanogaster) |
CCAP-R-Gal4 (CCAP-RMI05804-GAL4) |
Diao et al. (2015)
(doi: 10.1016/j.celrep.2015.01.059) |
N/A | |
| Genetic reagent (D. melanogaster) |
CCAP-R-Gal4DBD (CCAP-RMI05804-GAL4DBD) |
This paper | N/A | Split Gal4 hemidriver |
| Genetic reagent (D. melanogaster) |
CCAPR-p65AD (CCAP-RMI05804-p65AD) |
This paper | N/A | Split Gal4 hemidriver |
| genetic reagent (D. melanogaster) |
CCAP-Gal4DBD |
Luan et al. (2006b)
(PMID: 17088209) |
N/A | |
| Genetic reagent (D. melanogaster) |
Burs-LexA::VP16AD | This paper | N/A | LexA driver |
| Genetic reagent (D. melanogaster) |
RK-Gal4 (Rkpan-Gal4) |
Diao and White (2012)
(doi: 10.1534/genetics.111.136291) |
N/A | |
| Genetic reagent (D. melanogaster) |
RK-Gal4DBD (RkTGEM-Gal4DBD) | This paper | N/A | Split Gal4 hemidriver |
| Genetic reagent (D. melanogaster) |
RK-p65AD (RkTGEM-p65AD) | This paper | N/A | Split Gal4 hemidriver |
| Genetic reagent (D. melanogaster) |
RK- LexA::QFAD (RkTGEM- LexA::QFAD) |
This paper | N/A | Split Gal4 hemidriver |
| Genetic reagent (D. melanogaster) |
VGlut-LexA::QFAD (VGlutMI04979-LexA::QFAD) |
Diao et al. (2015)
(doi: 10.1016/j.celrep.2015.01.059) |
N/A | |
| Genetic reagent (D. melanogaster) |
VGlut-Gal4DBD (VGlutMI04979-Gal4DBD) |
Diao et al. (2015)
(doi: 10.1016/j.celrep.2015.01.059) |
N/A | |
| Genetic reagent (D. melanogaster) |
UAS-GCaMP6S, insertions on Chromosomes II and III |
Bloomington Drosophila Stock Center (BDSC) |
42746; 42749 | |
| Genetic reagent (D. melanogaster) |
UAS-Kir2.1 insertions on Chromosomes II and III |
Bloomington Drosophila Stock Center |
6596 | |
| Genetic reagent (D. melanogaster) |
UAS-dTrpA1 | other | BDSC 26263 | Paul Garrity, Brandeis |
| Genetic reagent (D. melanogaster) |
tubP-Gal80ts-20 | Bloomington Drosophila Stock Center |
7019 | |
| Genetic reagent (D. melanogaster) |
UAS-P2X2 | other | N/A | Orie Shafer, Univ. of Michigan |
| Genetic reagent (D. melanogaster) |
MiMIC CCAP-R[MI05804] | Bloomington Drosophila Stock Center |
BDSC 40788 | |
| Genetic reagent (D. melanogaster) |
UAS-6XEGFP on II and III | Bloomington Drosophila Stock Center |
52261; 52262 | |
| Genetic reagent (D. melanogaster) |
UAS-6XmCherry on III | Bloomington Drosophila Stock Center |
52268 | |
| Genetic reagent (D. melanogaster) |
24B (How)-Gal4 | Bloomington Drosophila Stock Center |
1767 | |
| Genetic reagent (D. melanogaster) |
{nosCas9} attP2 line |
Ren et al. (2013)
(doi: 10.1073/pnas.1318481110) |
||
| Genetic reagent (D. melanogaster) |
W1118 | other | White lab stock | |
| Antibody | Rabbit polyclonal anti-pBurs | other | N/A | Aaron Hsueh/Willi Honegger, Used at 1:1000 |
| Antibody | Alexafluor555-conjugated guinea pig anti-mouse |
Invitrogen | 1789887 | |
| Recombinant DNA reagent |
U6b-sgRNA-short plasmid |
Ren et al. (2013)
(doi: 10.1073/pnas.1318481110) |
||
| Recombinant DNA reagent |
pT-GEM(1) plasmid |
Diao et al. (2015)
(doi: 10.1016/j.celrep.2015.01.059) |
||
| Recombinant DNA reagent |
pCAST-BursGal4DBD |
Luan et al. (2012) (doi: 10.1523/JNEUROSCI.3707–11.2012) |
||
| Recombinant DNA reagent |
pBS-KS-attB-SA-SD-0- T2A-P65AD vector |
Diao et al. (2015) (doi: 10.1016/j.celrep.2015.01.059) |
||
| Recombinant DNA reagent |
pBS-KS-ETHRMI00949- T2A-p65AD in 4B |
This paper | See Supplementary file 1 | |
| Sequence-based reagent |
guide RNA oligos for Rk gene: ttcgTAAGTGAACCTTCAATGTCT; aaacAGACATTGAAGGTTCACTTA |
Integrated DNA Technologies, Inc. | N/A | |
| Sequence-based reagent |
PCR primers for Rk left homology arm: acccaccggaccggtgcatgCAAC CTCGACCCTTCAGTTCC; GACCTGGGGCGGCCGCG ctagacattgaaggttcacttac; |
Integrated DNA Technologies, Inc. | N/A | |
| Sequence-based reagent |
PCR primers for Rk right homology arm: cctgggggcgcgccggtacGGTA ATATTACATTAATTATTCTAAC; GAACCTCCCCACTAGTG gagaaagggattgcagcaac; |
Integrated DNA Technologies, Inc. | N/A | |
| Sequence-based reagent |
Drosophilized LexA::VP16AD construct |
Epoch Life Science, Inc. | N/A | |
| Sequence-based reagent |
PCR primers for T2A-P65AD forward: cgcgccagcaagatcgaggg ccgcggcagcctg PCR primers for T2A-P65AD reverse: atgggattcagatcttta cttgccgccgcccag |
Integrated DNA Technologies, Inc. | N/A | |
| Peptide, recombinant protein |
Ecdysis Triggering Hormone 1 (ETH1) |
GenScript | P11731308 | |
| Commercial assay or kit |
||||
| Chemical compound, drug |
Alexa Fluor 594 Phalloidin | ThermoFisher, Scientific | A12381 | |
| Chemical compound, drug |
ATP | Sigma | A9187 | |
| Software, algorithm | PhaseFinder | This paper | https://github.com/BenjaminHWhite/PhaseFinder | Detects pupal ecdysis Phases in Ca++ activity records |