REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
rabbit α-Lamp2a	Abcam	Cat#ab18528; RRID: AB_775981
mouse α-p62	Abnova	Cat#H00008878-M01; RRID: AB_548364
rabbit α-LaminB1	Abcam	Cat#ab16048; RRID: AB_10107828
mouse α-GM130	BD Transduction Lab,	Cat#010823; RRID: AB_398142
mouse α-PolyQ	Chemicon	Cat#MAB1574; RRID: AB_94263
mouse α-dmLaminB	DSHB	Cat#ADL67.10; RRID: AB_528336
mouse α-γ-H2AX	Millipore	Cat#05-636; RRID: AB_309864
rabbit α-TFEB	Bethyl Labs	Cat#A303-673A; RRID: AB_11204751
rabbit α-Atg5	Novus Biological	Cat#NB110-53818; RRID: AB_828587
rabbit α-Atg13-P-S318	Rockland	Cat#600-401-C49S (Lot 27919); RRID: AB_11181153
rabbit α-phospho-p70S6K	Cell Signaling	Cat#9205S; RRID: AB_330944
mouse α–α-tubulin	SIGMA	Cat#T9026; RRID: AB_477593
chicken α-MAP2	Abcam	Cat#ab5392; RRID: AB_2138153
Chemicals, Peptides, and Recombinant Proteins
Bafilomycin A1	SIGMA	Cat#B1793
Rapamycin	Calbiochem	Cat#553210
Brefeldin A	SIGMA	Cat#B7651
Lipofectamine3000 reagent	Invitrogen	Cat#L3000-008
TRI Reagent	Invitrogen	Cat#T9424
SuperScript III Reverse Transcriptase	Invitrogen	Cat#18080-051
Critical Commercial Assays
UPL library	Roche	N/A
TaqMan Universal PCR Master mix	ThermoFisher Scientific	Cat#4304437
SuperSignal West Pico Chemiluminescent Substrate	ThermoFisher Scientific	Cat#34080
Experimental Models: Cell Lines
SK-N-BE(2)	ATCC	ATTC: CRL-2271
Experimental Models: Organisms/Strains
Mouse: C3;B6-Tg(Prnp-ATN1)84Dbo/Mmmh	MMRRC repository	RRID: MMRRC_000396-MU
Mouse: C3;B6-Tg(Prnp-ATN1)150Dbo/Mmmh	MMRRC repository	RRID: MMRRC_000398-MU
Mouse: B6CBAF1/OlaHsd	Harlan Olac, Bicester, UK	N/A
Mouse: B6.Tg(CAG-GFP-LC3)	[18]	MTA G. Bates
D. melanogaster: Elav-Gal4;Repo-Gal4,ubi-Gal80ts	This paper	N/A
D. melanogaster: UAS-LacZ	BDSC	#8529
D. melanogaster: UAS-sAtro75QN.	[14]	N/A
Epg5 p.Phe1604Glyfs∗20 fibroblasts	[21]	N/A
Human fibroblasts DRPLA17	Corriell	Coriell: GM13717
Human fibroblasts DRPLA16	Corriell	Coriell: GM13716
Human fibroblasts control, m, 51	MRC CNMD Biobank London	UN3373
Human fibroblasts control, m, 3	[21]	N/A
Oligonucleotides
Atg5 siRNA (5′-GGU UUG GAC GAA UUC CAA CUU GUU U-3′)	Eurofins Genomix; [45]	N/A
Atg6 siRNA (5′-ACA GUG AAU UUA AAC GAC AGC AGC U-3′)	Eurofins Genomix; [45]	N/A
non-specific control siRNA (5′-AGG UAG UGU AAU CGC CUU G-3′, 47%CG)	Eurofins Genomix	N/A
Primer: Hprt1 Forward: cctcctcagaccgcttttt Reverse: aacctggttcatcat cgctaa UPL: 95	This paper	N/A
Primer: β-actin Forward: aaggccaaccgtgaaaagat Reverse: gtggtacgac cagaggcatac UPL: 56	This paper	N/A
Primer: Tfeb Forward: gagctgggaatgctgatcc Reverse: gggacttctgca ggtcctt UPL: 22	This paper	N/A
Primer: Hprt1 Forward: tgatagatccattcctatgactgtaga Reverse: aagacat tctttccagttaaagttgag UPL: 22	This paper	N/A
Primer: Ctsb Forward: cttgctgtggtatccagtgtg Reverse: cacctgaaacca ggccttt UPL: 50	This paper	N/A
Primer: Prkag Forward: ctgtcagacatcctgcaagc Reverse: ctacattcacgg cggtcat UPL: 62	This paper	N/A
Primer: Bip Forward: gccaactgttgtaacaatcaaggtct Reverse: tgacttcaatct ggggaactc	This paper	N/A
Primer: Chop Forward: tccgcagcaggtgcag Reverse: tcctcataccaggctt cca	This paper	N/A
Primer: Xbp1 Forward: gccaactgttgtaacaatcaaggtct Reverse: ccaacttg tccagaatgccc	This paper	N/A
Recombinant DNA
p(RFP)-EGFP-LC3B	[46]	N/A
mCherry-LaminB1-10	gift from Michael Davidson	Addgene plasmid: #55069
Software and Algorithms
EthoVision 7XT	Noldus, Netherlands	N/A
Green and Red Puncta Colocalization macro, ImageJ	[47]	http://imagejdocu.tudor.lu/doku.php?id=plugin:analysis:colocalization_analysis_macro_for_red_and_green_puncta:start
Columbus	PerkinElmer, Hamburg	N/A
Image Studio Lite	Li-Cor	https://www.licor.com/bio/products/software/image_studio_lite/
GraphPad Prism	GraphPad Software	https://www.graphpad.com/how-to-buy/