Table 2.
Name | Analyzed regions relative to transcriptional start site of NR4A3 | No. of analyzed CpGs | Forward (5′ → 3′) | Reverse (5′ → 3′) | Annealing temperature (°C) | Cycle | Length(bp) |
---|---|---|---|---|---|---|---|
NR4A3-Region 1 | −551 to −24 | 51 | TTATGTAAGAGGAAAGTGTAGTT | CTCCATAAAATACCTAAAATAC | 54 | 48 | 528 |
NR4A3-Region 2 | −37 to +485 | 47 | AGGTATTTTATGGAGAG | AAAAATCACAACTACTATCC | 54.4 | 40 | 522 |
NR4A3-Region 3 | +6151 to +6535 | 15 | TTTGTTTTTGAGAGATTTTTTTT | AATAACTACTAATACTACTAC | 53.2 | 45 | 385 |
NR4A3-Region 4 | +7116 to +7432 | 9 | GAGGGTTGTAAGGGTTTTTT | CAAATCCTTTTAAAACTCTAC | 57.7 | 40 | 317 |