Table 1.
Amplified fragment | Product size (bp) | Primer names | Primer sequences (5′–3′) |
---|---|---|---|
Ribosomal 18S rDNAa | 1687 | Medlin A (F)b | AACCTGGTTGATCCTGCCAGT |
Piro_18S_1688_Rc | CGACTTCTCCTTCCTTTAAGTGATAAG | ||
Ribosomal 18s rDNAd | 681 | Piro_144_S | ACCGTGCTAATTGTAGGGCTAATACA |
BCOMMON2R | TGCTTTCGCAGTAGTTCGTC |
PCR performed by the Department of Pathobiology, Ontario Veterinary College, University of Guelph, Guelph, Ontario, Canada.
Primer A of Medlin et al (20) less polylinker region.
Equivalent to primer BN1700 of Ramos et al (21).
PCR performed by the Vector Borne Disease Laboratory, College of Veterinary Medicine, North Carolina State University, Raleigh, North Carolina, USA, using primers described by Schoelkopf et al (7).