TABLE 4.

Primers used in this study

Name	Oligonucleotide sequence (5′ to 3′)a	Purpose
cah_UFP1	tctcttgcgtgactgctctactgttaatagaataaaacgatcgataaaacCAACAAAGCCACGTTGTGTC	Deletion of cah
cah_DRP2	accgtcatcatccttaacatcaacggaagaatggcctgcagcaccatacaTCCCGTCAAGTCAGCGTAAT	Deletion of cah
cah-UFHindIII	gatcaagcttatcactgacctgcccg	Cloning of cah
cah-DRBamHI	gatcggatccatccccggtttgctgc	Cloning of cah
pBBR1MCS-F	gttttcccagtcacgacgtt	Specific to plasmid pBBR1MCS, upstream of the MCSb site
pBBR1MCS-R	ggctcgtatgttgtgtggaa	Specific to plasmid pBBR1MCS, downstream of the MCS site
cah-F1	atgcccctcctgtttctctt	Sequencing of cloned cah
cah-F2	accacaaatggtcgtcaggt	Sequencing of cloned cah
cah-F3	ggtaaggctgacggtgttgt	Sequencing of cloned cah
cah-F4	gttgtggatgcacagaatgg	Sequencing of cloned cah
cah-F5	ggagccacaactgcagtaca	Sequencing of cloned cah
cah-R1	ttcagaactgcggtgaacag	Sequencing of cloned cah
cah-R2	gacataccggcaacctctgt	Sequencing of cloned cah
cah-R3	gatgtccgacagtggtgttg	Sequencing of cloned cah
cah-R4	ccactgctcgcctctgttat	Sequencing of cloned cah
cah-R5	cgcaggccattaaccactat	Sequencing of cloned cah

^aNucleotides in uppercase font are specific to gene replacement vector pACYC177, and nucleotides in bold lowercase font represent the endonuclease restriction sites incorporated in the primers to facilitate cloning.

^bMCS, multiple-cloning site.