REAGENT or RESOURCE | SOURCE | IDENTIFIER |
---|---|---|
Antibodies | ||
anti-β-actin | Santa Cruz Biotechnology | Cat#SC-47778; RRID: AB_626632 |
anti-Myc-tag | Santa Cruz Biotechnology | Cat#SC-40; RRID:AB_627268 |
anti-SQSTM1/p62 | Santa Cruz Biotechnology | Cat#SC-28359 ; RRID: AB_628279 |
anti-LC3B | Cell Signaling Technology | Cat#3868S; RRID: AB_2137707 |
anti-ATG4B | Cell Signaling Technology | Cat#5299S; RRID: AB_10622184 |
anti-phosphor-Histone H2A.X (Ser139) | Cell Signaling Technology | Cat#9718S; RRID:AB_2118009 |
anti-Myc-Tag (Sepharose bead conjugate) | Cell Signaling Technology | Cat#3400S; RRID: AB_10692357 |
anti-ATG4A | Cell Signaling Technology | Cat#7613S; RRID: AB_10827645 |
anti-CD44 | Cell Signaling Technology | Cat#3570S; RRID: AB_10693293 |
anti-SOX2 | Cell Signaling Technology | Cat#3579S; RRID:AB_2195767 |
anti-MST1 | Cell Signaling Technology | Cat#14946 |
anti-MST2 | Cell Signaling Technology | Cat#3952; RRID: AB_10694853 |
anti-ATG4C | Cell Signaling Technology | Cat#5262S; AB_10626627 |
anti-phosphor-AKT (Ser473) | Cell Signaling Technology | Cat#4060S; RRID: AB_2315049 |
anti-AKT | Cell Signaling Technology | Cat#9272S; RRID: AB_329827 |
anti-phospho-p44/42 MAP kinase Thr202/Tyr204 | Cell Signaling Technology | Cat#9101S; RRID:AB_331646 |
anti-p44/42 MAP kinase | Cell Signaling Technology | Cat#9102S; RRID:AB_330744 |
anti-cleaved Caspase-3 (Asp175) | Cell Signaling Technology | Cat#9661S; RRID:AB_2341188 |
anti-ATG7 | Cell Signaling Technology | Cat# 8558, RRID:AB_10831194 |
anti-ATG5 | Cell Signaling Technology | Cat# 12994, RRID:AB_2630393 |
anti-ATG4D | Proteintech Group | Cat#16924-1-AP;RRID:AB_2062024 |
anti-MST4 (for IB, IHC and IF) | Abcam | Cat#ab52491; RRID:AB_881249 |
anti-p-S383-ATG4B | Abmart | NA |
anti-ATG4B | Abmart | NA |
anti-Flag | Sigma-Aldrich | Cat#F3165;RRID:AB_259529 Cat#F7425; RRID:AB_439687 |
anti-p-Ser | Thermo Fisher Scientific | Cat# 61-8100, RRID:AB_2533940 |
Peroxidase-IgG Fraction Monoclonal Mouse Anti-Rabbit IgG, Light Chain Specific | Jackson ImmunoResearch Laboratories | Cat# 211-032-171; RRID:AB_2339149 |
anti-Ki-67 | EMD Millipore | Cat#AB9260, RRID:AB_2142366 |
Alexa Fluor 488 | Thermo Fisher Scientific | Cat# A-11008, RRID:AB_143165 |
Alexa Fluor 594 | Thermo Fisher Scientific | Cat# R37117, RRID:AB_2556545 |
Horseradish Peroxidase Streptavidin antibody | Vector Laboratories | Cat# SA-5004, RRID:AB_2336509 |
Anti-Mouse IgG (H+L), rat adsorbed, made in horse antibody | Vector Laboratories | Cat# BA-2001, RRID:AB_2336180 |
Biotinylated Goat Anti-Rabbit IgG antibody | Vector Laboratories | Cat# BA-1000, RRID:AB_2313606 |
anti-Rabbit Immunoglobulins | DAKO | Cat# P0217 |
anti-Mouse Immunoglobulins | DAKO | Cat# P0260 |
anti-Goat Immunoglobulins | DAKO | Cat# P0449 |
Biological Samples | ||
Paraffin-emended GBM tissue | Saitama Medical University | Saitama, Japan |
Chemicals, Peptides, and Recombinant Proteins | ||
Chloroquine (CQ) | Sigma | Cat#C6628 |
NSC185058 | NCI Developmental Therapeutics Program | NIH, NCI, USA |
AquaBlock | East Coast Bio | Cat#PP82 |
Propidium Iodide | BD Biosciences | Cat#556463 |
Annexin V-APC | BD Biosciences | Cat#550475 |
Vybrant™ DyeCycle™ Violet Stain | Thermo Fisher Scientific | Cat#V35003 |
S-Adenosyl Methione | New England Biolabs | Cat#B9003S |
DNA methyltransferase | New England Biolabs | Cat#M0230S |
BsmBI | New England Biolabs | Cat#R0580S |
Vectashield mounting medium with DAPI | Vector Laboratories | Cat#H-1200 |
Bsh1236I (BstUI) | Thermo Fisher Scientific | Cat#ER0921 |
Hesperadin | Selleckchem | Cat#S1529 |
PD98059 | Selleckchem | Cat#S1177 |
Lipofectamine 2000 | Thermo Fisher Scientific | Cat#11668019 |
Kinase buffer | Cell Signaling Technology | Cat#9802 |
ATP | Cell Signaling Technology | Cat#9804 |
D-Luciferin | Gold Bio | Cat#LUCK |
Peanut oil | Sigma-Aldrich | Cat#2144 |
Protease Inhibitor Cocktail | Sigma-Aldrich | Cat# 11836153001 |
Phosphatase inhibitor | Sigma-Aldrich | Cat# 4906837001 |
Protein G Agarose | Sigma-Aldrich | Cat# 16-266 |
2% paraformaldehyde/2.5% glutaraldehyde | Polysciences | Cat#22872 |
IP Lysis Buffer | Thermo Fisher Scientific | Cat#87788 |
O.C.T Compound | Thermo Fisher Scientific | Cat#23-730-571 |
Critical Commercial Assays | ||
QuikChange mutagenesis kit | Agilent Technologies | Cat#200515-5 |
CellTiter Glo 2.0 | Promega | Cat#G9241 |
Epitech bisulphite conversion kit | Qiagen | Cat#59104 |
QIAquick Gel Extraction kit | Qiagen | Cat#28704 |
Deposited Data | ||
GSC microarray | Mao et al., 2013 | GSE67089; (Mao et al., 2013) |
GSC 450K DNA methylation array | This and another studies | Deposited to GEO as GSE90948. |
Experimental Models: Cell Lines | ||
M83 | Mao et al., 2013 | N/A |
1123 | Mao et al., 2013 | N/A |
30 | Mao et al., 2013 | N/A |
528 | Mao et al., 2013 | N/A |
17 | Mao et al., 2013 | N/A |
19 | Mao et al., 2013 | N/A |
84 | Mao et al., 2013 | N/A |
157 | Mao et al., 2013 | N/A |
HEK293T | ATCC | ATCC CRL-3216 |
JK42 | Srikanth et al., 2013 | N/A |
JK83 | Srikanth et al., 2013 | N/A |
JK44 | Srikanth et al., 2013 | N/A |
JK46 | Srikanth et al., 2013 | N/A |
JK18 | Srikanth et al., 2013 | N/A |
JK34 | Srikanth et al., 2013 | N/A |
JK92 | Srikanth et al., 2013 | N/A |
JK16 | Srikanth et al., 2013 | NA |
23 | Bhat et al., 2013 | NA |
543 | Rohle et al., 2013 | N/A |
600 | Rohle et al., 2013 | N/A |
Experimental Models: Organisms/Strains | ||
Athymic (Ncr nu/nu) mice | Taconic Farms | N/A |
Oligonucleotides | ||
lentiCRIPSRv2GFP-STK26-KO-1 construction primers: F: CACCGTTGGACAGCCACCGGCGAGT R: AAACACTCGCCGGTGGCTGTCCAAC |
IDT | N/A |
lentiCRIPSRv2GFP-STK26-KO-2 construction primers: F: CACCGCCGGTGGCTGTCCAAGTGCC R: AAACGGCACTTGGACAGCCACCGGC |
IDT | N/A |
STK26 genomic DNA sequencing primer: F: CTCTTCCTAAAGCGGCGAGG R: CAGCATTTCTCACGCCACAC |
IDT | N/A |
Recombinant DNA | ||
TRC shRNA Control | Dharmacon | Cat#RHS6848 |
GIPZ shRNA Control | Dharmacon | Cat#RHS4346 |
ATG4B shRNA #1 | Dharmacon | TRCN0000073798 |
ATG4B shRNA #4 | Dharmacon | TRCN0000073801 |
ATG4B shRNA #5 | Dharmacon | TRCN0000073802 |
ATG4B shRNA (Target 3’UTR) | Dharmacon | V3SH7591-225104933 |
MST4 shRNA #1 | Dharmacon | TRCN0000003192 |
MST4 shRNA #2 | Dharmacon | TRCN0000003193 |
MST4 shRNA (Target 3’UTR) | Dharmacon | V3SH7590-225006062 |
ATG5 shRNA | Dharmacon | V2LHS_248503 |
ATG7 shRNA | Dharmacon | V2LHS_13452 |
pCDH-MST4 WT and mutants | This study | N/A |
pCDH-MST4 K53E | This study | N/A |
pCDH-MST4 T178A | This study | N/A |
pCDH-ATG4B WT | This study | N/A |
pCDH-ATG4B C74S | This study | N/A |
pCDH-ATG4B S383A | This study | N/A |
pCDH-ATG4B S383D | This study | N/A |
pcDNA-myc-MST4 WT | This study | N/A |
pcDNA-myc-MST4 K53E | This study | N/A |
pcDNA-Flag-ATG4B WT and domain deleted mutants | (Kuang et al., 2012) | N/A |
pcDNA-Flag-ATG4B S383A | This study | N/A |
pcDNA-mycMST4 1-279/280-416 | This study | N/A |
lentiCRISPRv2GFP | (Walter et al., 2017) | Addgene #82416 |
psPAX2 | Didier Trono | Addgene #12260 |
pCMV-VSV-G | (Stewart et al., 2003) | Addgene #8454 |
pET28a -ATG4B WT and C74S | (Li et al., 2011) | (Li et al., 2011) |
pET28a -FRET-LC3B | (Li et al., 2012) | (Li et al., 2012) |
Software and Algorithms | ||
Firebrowse | http://firebrowse.org/ | |
Betastasis | www.betastasis.com/glioma/tcga_gbm/ | |
gRNA design MIT on line tool | http://crispr.mit.edu | |
Other | ||
PrepEase | USB | Cat# P-78796B |
Superdex 75 column | GE Health | Cat# 1068-01 |
pGEM-T | Promega | Cat#: A3600 |