Table 1.
Somatic mutations of FOXA2 in uterine carcinosarcomas and endometrial carcinomas
| Tumor ID | Tumor histology | Nucleotide change§ | Somatic mutation type | Predicted protein change |
|---|---|---|---|---|
| Uterine carcinosarcoma (UCS) mutations | ||||
| 189T | UCS | c.621C>G | Missense | p.I207M |
| 190T | UCS | c.710C>T | Missense | p.P237L |
| 195T¶ | UCS | c.1034_1053delCCGCGGCCCACCTGCTGGGC | Frameshift | p.A347Pfs*8 |
| 1241T | UCS | c.401_402insCC | Frameshift | p.M136Pfs*8 |
| 1338T | UCS | c.587delA | Frameshift | p.Y196Sfs*23 |
| 1413T | UCS | c.462_463insT | Frameshift | p.Y155Lfs*84 |
| 1828T | UCS | c.716C>A | Nonsense | p.S239* |
| 1980T | UCS | c.912_913insACTCGAGCGCCTT | Frameshift | p.P310Lfs*56 |
| Endometrial carcinoma (EC) mutations | ||||
| 84T | EEC | c.1039_1055delGCCCACCTGCTGGGCCC | Frameshift | p.H348Pfs*8 |
| 94T | EEC | c.445_446insCCCGCGCGCCCGCGACCCCA | Frameshift | p.K149Tfs*39 |
| 97T | EEC | c.201-202insACGG | Frameshift | p.Y68Tfs*172 |
| 124T | EEC | c. 1035_1046delCGCGGCCCACCTinsTGCG | Frameshift | p.H348Gfs*11 |
| 134T | EEC | c.318_325delGAGTCCCA | Frameshift | p.S107Pfs*129 |
| 146T | EEC | c.1039_1046delGCCCACCT | Frameshift | p.H348Gfs*11 |
| 43T | SEC | c.816delC | Frameshift | p.S272Rfs*51 |
| 49T | SEC | c.1044_1045delCC | Frameshift | p.L349Afs*12 |
| 75T | SEC | c.1036_1049delGCGGCCCACCTGCT | Frameshift | p.A346Gfs*11 |
| 24T | CCEC | c.453_454insA | Frameshift | p.R152Kfs*87 |
| 28T | CCEC | c.807_820delCGCCGGCAGCGGCAinsTGC | Frameshift | p.G271Efs*87 |
| 34T | CCEC | c.315_316insT | Frameshift | p.L106Ffs*133 |
| 46T | CCEC | c.743_756delACCTGCGCCGCCAG | Frameshift | p.Y248* |
| 77T | CCEC | c.806C>T | Missense | p.A269V |
| 15T | Mixed EC | c.594_604delGAACCAGCAGCinsA | Frameshift | p.N199Afs*17 |
| 176T | Mixed EC | c.1028_1029insG | Frameshift | p.Q344Afs*18 |
§
FOXA2 Transcript and protein accession numbers for variant annotation: NM153675 and NP710141
¶
FOXA2 mutation detected in 195T was discovered by Sanger sequencing the 14 discovery screen tumors.
Abbreviations: UCS, uterine carcinosarcoma; EEC, endometrioid endometrial carcinoma; SEC, serous endometrial carcinoma; CCEC, clear cell endometrial carcinoma; mixed EC, mixed histology endometrial carcinoma.