Table 3.
Primers used in this work.
| Primer | Sequence | Amplicon target |
|---|---|---|
| ScbA-jostii-NdeI-F | GCGATACATATGGCGCAAATTTCCCGGCCGAT | R. jostii gblA gene |
| ScbA-jostii-BamHI-R | CGCTATGGATCCCTAGCGAGCGCATGCGCTCA | R. jostii gblA gene |
| afsA-del-GTG-FW-XbaI | GATTATCTAGAGAAGACCTCGGCCACGGATTG | Upstream region of R. jostii gblA gene for deletion |
| afsA-del-GTG-Rv-EcoRI | TACTTGAATTCGGGCTTTCGTGAACGACCTC | Upstream region of R. jostii gblA gene for deletion |
| afsA-del-UAG-Rv-XbaI | GATTATCTAGAGACGAGCGAGCCACGATCC | Downstream region of R. jostii gblA gene for deletion |
| afsA-del-UAG-Fw-PstI | GTCAACTGCAGGCCGGGCGAGATCGTTCAC | Downstream region of R. jostii gblA gene for deletion |
| afsA-del-check-1-Fw | CGACGCCGACTAGCGAGC | Primer annealing outside the 1.5 KB homologous region used for the double recombination to delete afsA |
| afsA-del-check-1-Rv | TGGTCGCGGTTACTGGACAC | Primer annealing outside the 1.5 KB homologous region used for the double recombination to delete afsA |
| afsA-del-Check-2-FW | TGGCAGGCGTGGAACACGTC | Primer annealing outside the 1.5 KB homologous region used for the double recombination to delete afsA |
| afsA-del-check-2-Rv | GTCGTTCGAGCGGACCGTTC | Primer annealing outside the 1.5 KB homologous region used for the double recombination to delete afsA |
| pSET152-CS-Fw | TACCGCATCAGGCGCCATTC | Primer annealing at one side of the insertion in PMR4 |
| pSET152-CS-Rv | TTATGCTTCCGGCTCGTATG | Primer annealing at one side of the insertion in PMR4 |