. 2017 Dec 20;8(1):26. doi: 10.1007/s13205-017-1041-x

Table 1.

Primers used in this study

Primer name	Primer sequence (5′–3′)	Description
BXL-QC1F	CGGGGTACCGGCCCTGGCGCAAAACAATC	For amplification of the 946-bp fragment I
BXL-QC1R	CCGAGCTCAGCGGCAGACGACTGGTTGC	For amplification of the 946-bp fragment I
BXL-F	ATGGTGAATAACGCAGCTCTTCTCG	For amplification of the 2394-bp bxyl gene
BXL-R	TTATGCGTCAGGTGTAGCATCCTTG	For amplification of the 2394-bp bxyl gene
Hph-F	CGACAGCGTCTCCGACCTGA	For detection of the 811-bp hph gene fragment
Hph-R	CGCCCAAGCTGCATCATCGAA	For detection of the 811-bp hph gene fragment
HtrpC-F	AGGAATAGAGTAGATGCCGACC	For detection of the 1748-bp knockout fragment
BXL-YZR	TGTAGCATCCTTGATCTGTTGC	For detection of the 1748-bp knockout fragment