Table 2. DNA binding constants determined by SPR for dsDNA containing AATAAT_ATTATT, AATT, (AT)₄ and (CG)₄ sequences^‡.

	KD (× 10−6M)a
	dsDNA	dsDNA	dsDNA	dsDNA
	GGAATAATCGCGATTATTCC	CGAATTCG	CATATATAT	CGCGCGCG
HMGA1a (Δ50–91)	K 1 = 0.35	ndb	nd	nd
	K 2 = 11.3
HMGB1	K 1 = 0.33	nd	nd	nd
	K 2 = 5.91
1	K 1 = 0.56	K 1 = 0.166c,d	K 1 = 0.307d	> 10d
	K 2 = 74.7	K 2 = 207	K 2 = 20.91
2	K 1 = 0.43	K 1 = 0.262	K 1 = 0.65	K = 6.85e
	K 2 = 20.8	K 2 = 230	K 2 = 39

^‡dsDNA hairpins used in the study (the loop is underlined): 5’-biotin-GGGGAATAATCGCGATTATTCCCCAATAATCGCGATTATT [AATAAT_ATTATT], 5’-biotin-CGAATTCGTCTCCGAATTCG-3’ [AATT], 5’-biotin-CATATATATCCCCATATATATG-3’ [(AT)₄], and 5’-biotin-CGCGCGCGTTTTCGCGCGCG-3’ [(CG)₄].

^aBinding constants for fitting to a two-site binding model.

^bNot determined.

^cPrimary binding constant for fitting to a two-site binding model. The secondary binding constant (K₂) corresponds to nonspecific binding to the hairpin loop (62).

^d(10).

^eBinding constant for fitting to a one-site binding model.