Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
| Gene-/_Primer-name | Sequence in 5′-3′- orientation |
|---|---|
| hZNF467_1fw | agctccctgggattctctgt |
| hZNF467_1re | catctgctcctgggcattat |
| hRGS19_5fw | cgaggctcatctacgaggac |
| hRGS19_5re | ggctcctgcatcttcttgtt |
| hUSE1_2fw | ggacaaccagaccctgtcac |
| hUSE1_2re | gacgctctgactccgtcttc |
| hSumo3_6fw | ggcagccaatcaatgaaact |
| hSumo3_6re | aacacgtcgatggtgtcctc |
| hLaminA/C_fw | tgcgtacggctctcatcaact |
| hLaminA/C_re | ctcgtcgtcctcaaccacagt |
