Table 1. Primers used in this study.

Primer	Sequence (5’–3’)	Description
G1	CGCGGATCCATGGCAGTAAAAGTAGCAA	The forward primer of GapC, plus Bam HI site
G2	CCCAAGCTTTTTAGAAAGTTCAGCTAAG	The reverse primer of GapC, plus Hind III site

Note: BamH I and Hind III restriction enzyme sites were introduced at the 5’ end of the primers as indicated italics.