Figure 2.

Identification of a KBS in Mmp1 promoter. A, Mmps mRNA levels in EGFP-overexpressing (as a control) and Kr-h1–overexpressing Drosophila Kc cells. B and C, dual luciferase assay. Kc cells were co-transfected with a Kr-h1 expression construct (EGFP was used as a control) and pGL3-basic plasmids containing different lengths of the Mmp1 promoter region or the −2000 to −1000 fragment with specific deletions (B). From the localization in B, a sequence was identified in a fragment −1473 to −1308 and a specific sequence CTCAATAACCTATGCCACAT (KBS) in one or four copies (C). Dual luciferase assays were performed at 48 h post-transfection. The luciferase activity fold change was defined as the relative luciferase activity induced by Kr-h1 overexpression compared with EGFP overexpression. D, alignment of KBS in promoters of silkworm Br-C and E93 and Drosophila Mmp1. E, EMSA. His-Kr-h1 protein was purified from E. coli and incubated with a three times repeated KBS probe labeled with Cy5 for 2 h. Competition assays were performed using 100-fold molar excess of unlabeled specific or nonspecific probes.