Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Mus musculus) | Itsn2 | NA | ENSMUSG00000020640; MGI:1338049 | |
| Genetic reagent (M. musculus) | Itsn2-/- | KOMP consortium | RRID:MGI:5631233 | Itsn2tm1.1(KOMP)Vlcg |
| Genetic reagent (M. musculus) | µMT | doi:10.1038/350423a0 | RRID:IMSR_HAR:1682 | (beta)-globin (mu)MT-/- |
| Genetic reagent (M. musculus) | MD4 | doi:10.1038/334676a0 | RRID:MGI:5006966 | Tg(IghelMD4)4Ccg |
| Genetic reagent (M. musculus) | OTII | doi:10.1046/j.1440–1711.1998.00709.x | RRID:IMSR_JAX:004194 | B6.Cg-Tg(TcraTcrb)425Cbn/J |
| Cell line (M. musculus) | A20 cells with HEL-specific D1.3 BCR | http://dx.doi.org/10.1016/S1074-7613(00)80580–4 | ||
| Transfected construct (plasmid) | ITSN2L GFP | Michael Way | pEGFP-C1 ITSN2L | |
| Antibody (rabbit polyclonal) | anti-ITSN2 antibody | Novus | NBP1-71833; RRID:AB_11038593 | 1:1000 in 5% Milk TBS-T |
| Sequence-based reagent | sgRNA1 | this paper | Forward - CACCGTAGCTATAGAGAACTCTTGC; Reverse - AAACGCAAGAGTTCTCTATAGCTAC | |
| Sequence-based reagent | sgRNA 2 | this paper | Forward - CACCGGGGGTTGTTTCATGATAGGA; Reverse - AAACTCCTATCATGAAACAACCCCC | |
| Peptide, recombinant protein | Eα peptide | The Francis Crick Institute peptide chemistry unit; doi:10.1038/353660a0 | Sequence: Biotin-GSGFAKFASFEAQGALANIAVDKA-COOH |