Fig. 1.

(A) Volcano plot for the comparison of RNA-seq data between PP and NP. Nonchanged genes are shown in blue, while differently expressed genes (fold-change > 2 and FDR < 0.05) are denoted in red or green. n = 3. (B) Validation of PTGS2 gene expression by quantitative RT-PCR. Data are presented as the mean ± SEM. Primer sequences: PTGS2-Forward: cagatgactgcccaactccc, PTGS2-Reverse: tgaacccaggtcctcgctta; RPL7-Forward: gcagatgtaccgcactgagattc, RPL7-Reverse: acctttgggcttactccattgata. (C) Western blot validation. Antibodies for PTGS2 (D5H5, 74 kDa) and ACTB (D6A8, 45 kDa) were obtained from Cell Signaling Technology.