TALEN-Mediated Mutagenesis and Genome Editing

Summary

Transcription activator-like effectors (TALEs) are important genomic tools with customizable DNA binding motifs for locus-specific modifications. In particular, TALE Nucleases or TALENs have been successfully used in the zebrafish model system to introduce targeted mutations via repair of double stranded breaks (DSBs) either through non-homologous end joining (NHEJ), or by homology-directed repair (HDR) and homology-independent repair in the presence of a donor template. Compared with other customizable nucleases, TALENs offer high binding specificity and fewer sequence constraints in targeting the genome, with comparable mutagenic activity. Here, we describe a detailed in silico design tool for zebrafish genome editing for TALENs and CRISPR/Cas9 custom restriction enzymes using Mojo Hand 2.0 software.

1. Introduction

TALEs are naturally occurring transcription factors isolated from plant pathogen Xanthomonas (1,2). Each TALE has a DNA recognizing TALE domain made up of a tract of almost identical repetitive units (33–35 amino acid residues) and a partial (or half) repeat unit at the end. Within each unit, the two repeat-variable di-residues (RVDs) are solely responsible for the binding specificity of the unit towards a DNA nucleotide in a highly predictable fashion (3,4). Commonly used RVDs include NI, NN for adenine; HD for cytosine; NK, NN, NH for guanine and NG for thymine (3–6). Because of the 1:1 RVD to nucleotide modularity of the TALE domain, it can be engineered to target almost any DNA sequence in the genome and can be fused with different functional domains including nuclease, transcription activator/repressor, and methyltransferases. TALEs represent important genomic tools for locus-specific modifications (7–14). In particular, TALENs have been extensively used for targeted mutations in vitro and in different model organisms (15–22).

Diverse methodologies have been developed to assemble the modular TALE domain, with the Golden Gate TALEN assembling method (Golden Gate TALEN Kit 2.0) being widely used because of its flexibility, low start-up cost and requirement of minimal, common molecular cloning reagents (23). We previously reported the first use of GoldyTALEN in targeted zebrafish genome editing through both NEHJ and HDR (8). We also described a simple and highly active GoldyTALEN design with only 15 RVDs (or 14.5 TALE repeats) (22). To further facilitate TALEN-mediated high throughput genome editing, we subsequently developed a modified Golden Gate TALEN assembling FusX system (Ma et al., manuscript in preparation). The new system increased assembling efficiency, but shortened assembling time without affecting mutagenic activity and compatibility.

With the rapid development of novel genome engineering tools such as TALENs and CRISPR/Cas9 systems (24), new software tools are needed to aid biologists in designing and constructing high efficiency reagents that can be used to make tailored changes within any model system of interest. Through a better understanding of the cell’s endogenous DNA repair mechanisms, we can improve reagent design and targeting to achieve predictable outcomes. Microhomology mediated end joining (MMEJ) appears to be a dominant repair pathway for TALEN and RNA-guided engineered nucleases (RGEN) induced double stranded breaks and has been used to generate predictable out-of-frame deletions and to incorporate donor DNA sequences in a highly efficient manner (25).

We previously presented the web-based Mojo Hand designer tool (26). In the latest version 2.0, algorithm adheres to the same general steps that the original algorithm follows with the integration of new features including .bed file creation, microhomology and out-of-frame scoring. Another major consideration was the incorporation of user generated next generation sequencing data in reagent design to deal with the tremendous inter- and intrastrain genetic variation during zebrafish genome targeting. In the current version, high-depth RNAseq datasets were integrated to simplify design and reduce time and cost through the avoidance of regions rich in single nucleotide polymorphisms (SNPs). Here, we describe a detail protocol of targeted zebrafish genome editing through NHEJ and HDR, respectively, using TALENs or CRISPR/Cas9 using the open access Mojo Hand 2.0 software.

2. Materials

2.1 Zebrafish embryo genotyping and RFLP assay

1. Genomic DNA extraction buffer: 10 mM Tris-HCl, pH 8.3, 50 mM KCl

2. 10% Tween-20

3. 10% NP-40

4. Proteinase K solution (Recombinant, PCR Grade, 14–22 mg/mL in 10 mM Tris-HCl, pH 7.5, Roche Life Science)

5. PCR reaction mix (see ^{Note 1})

6. Restriction enzyme

7. Agarose

8. TAE Buffer (1×): 40 mM Tris-HCl, 20 mM acetic acid, 1 mM EDTA, pH 8.4

9. Standard gel Electrophoresis system

2.2 TALEN Assembling

• 1FusX collection (pFusX1 – 4 and pFusX_B2) (Addgene in progress)
• 2Last half-repeat components pLR-NI, -HD, -NN, and -NG (Addgene #31006, #30984, #31017, #30995)
• 3RCIscript-GoldyTALEN backbone (Addgene, cat# 38142)
• 4T4 DNA Ligase (2,000,000 units/mL, New England Biolabs)
• 5BsmBI (New England Biolabs) (optional, see ^{Note 2})
• 6Esp3I (Thermo Scientific)
• 7Standard thermocycler
• 7Competent E. coli cell
• 8LB agar plate with ampicillin (100 μg/mL)
• 9LB medium with ampicillin (100 μg/mL)
• 1020 mg/mL X-Gal (5-bromo-4-chloro-3-indolyl-β-D-galactoside)
• 110.1M IPTG (isopropylthio-β-galactoside)
• 12Colony PCR screening primers: TAL_F1 (ttggcgtcggcaaacagtgg) and TAL_R2 (ggcgacgaggtggtcgttgg) (23)
• 13Sequencing primers: TAL_F1, TAL_R2, RVD-MM-F (ctcacacccgatcaggtc) and RVD-MM-R (gacctgatcgggtgtgag) (see ^{Note 3}) (24)

2.3 In vitro Transcription

1. SacI (New England Biolabs)

2. 3 M sodium acetate, pH 5.0

3. 70% ethanol

4. Ambion mMESSAGE mMACHINE® T3 Transcription Kit (Life Technologies)

5. Deionized water

6. Lithium Chloride precipitate solution: 7.5 M LiCl, 50 mM EDTA, pH 8.0

3. Methods

3.1 Designing TALEN with Mojo Hand 2.0 (Fig. 1, see ^{Note 4})

Figure 1.

Typical genomic region for TALEN targeting in different types of mutagenesis. Either TALEN Pair 1 or 2 can be used in case of loss-of-function mutagenesis and TALEN pair 1 and 2 are used together for deletion of large genomic fragment. Blue arrow indicated primer pairs for RFLP or PCR screening of mutagenesis.

1. Select genomic region for TALEN targeting (Fig. 2, see ^{Note 5})

2. Sequence Input into Mojo Hand 2.0 (http://talendesign.org/)

3. Identification of Binding Sites with the following parameters (^{Note 6}):

   1. Length of TAL binding domain 15RVDs

   2. Spacer length between 14–18 bp

   3. Unique restriction site within the spacer for RFLP assay of NHEJ-mediated mutagenesis (optional for large genomic fragment deletion using two pairs of TAELN, see ^{Note 7})

   4. T nucleotide upstream of both TAL binding domains

4. Restriction enzyme analysis

5. Mojo Hand Output

6. Select TALEN design with desired Microhomology Score above or Out-of-frame Score if predictable deletion through MMEJ is desirable (^{Note 8})

7. Generate BED File to be used in conjunction with Integrated Genomics Viewer (IGV) (^{Note 9})

Figure 2.

Picking corresponding component vectors from FusX libraries to assembly 15-RVD GoldyTALEN

3.2 Genotyping targeted genomic locus

1. Design primers to amplify the targeted locus (see ^{Note 10}).

2. Extract genomic DNA from zebrafish embryos of the targeted fish line (see ^{Note 11})

   1. To prepare 1 mL working extraction buffer, freshly add 30 μL 10% Tween-20, 30 μL 10% NP-40 and 10 μL Proteinase K to 950 μL genomic DNA extraction buffer

   2. Transfer embryos to centrifuge tube and remove excess embryo water

   3. Add working extraction buffer (50 μL per embryo)

   4. Incubate at 55 °C with shaking ≥ 4 hours

   5. Incubate at 98 °C for 10 min to inactivate Proteinase K

   6. Store genomic DNA at −20 °C until PCR

   7. Typically, 5 μL of genomic DNA solution are used in 25 μL PCR reaction

3. PCR amplify the target locus

4. Test RFLP assay

   1. PCR with RFLP assay primers (see ^{Note 10}, Fig. 2)

   2. digest 10 μL PCR product with appropriate restriction enzyme

   3. Resolve digested product on 1.5% Agarose gel

   4. PCR product should be completely digested into two correctly sized bands

5. Confirm sequence of the targeted locus by Sanger Sequencing and identify any polymorphic region affecting TALEN binding sites, re-design TALEN if necessary.

3.3 Design short single-stranded donor oligo

1. Design donor oligo with the following parameters:

   1. Around 50 base pairs in length

   2. Mutated nucleotide(s) in the middle part of the oligo

   3. Unique restriction site added in the middle of the oligo by introducing silent mutations to allow easy screening of donor incorporation with RFLP assay

3.4 TALEN Assembling with FusX System (3-days)

3.4.1 Day 1

• 1Breakdown the 15-RVD TALE domain from 5′ to 3′ into 6 building blocks from different libraries of the FusX kit according to the formula 3 (pFusX-1) + 3 (pFusX-2) + 3(pFusX-3) + 3 (pFusX-4) + 2 (pFus_B2) + 1 (pLR) (Fig. 2)

For example:

A TALEN arm with the following targeting sequence: 5′-ATTGACTTCAGAGAG-3′

Corresponding RVD sequences: NI NG NG NN NI HD NG NG HD NI NN NI NN NI NN

List of building blocks required for each TAL:

Library	RVD sequence
pFusX-1	NI NG NG
pFusX-2	NN NI HD
pFusX-3	NG NG HD
pFusX-4	NI NN NI
pFus_B2	NN NI
pLR	NN

• 5Mix 25–50 ng of each vector in a PCR tube with 50 ng RCIscript-GoldyTALEN backbone (see ^{Note 12})
• 6(Optional) Add to each reaction, 1 μL 10X NEBuffer 3.1, 0.5 uL BsmBI and make up to 10 μL with deionized water (see ^{Note 2})
• 7(Optional) Incubate at 55ºC for 30 min (see ^{Note 2})
• 8Add to each reaction 1.5 μL 10X T4 DNA Ligase Reaction Buffer, 0.5 μL T4 DNA Ligase, 0.5 μL Esp3I and make up to 15 μL with deionized water
• 9Run the follow program in thermocycler:

  1. 37 °C, 5 min and 16 °C, 10 min → 10 cycles,

  2. 37°C, 15 min,

  3. 80°C, 5 min,

  4. 4°C forever

• 10Transform 3–5 μl of the reaction product and plate ~1/5 of the recovered transformants on LB agar plate with ampicillin, 40 μL X-Gal (20 mg/mL) and 40 μL 0.1M IPTG
• 11Incubate LB agar plate at 37°C overnight

3.4.2 Day 2

1. Pick 2–4 white colonies for colony PCR with primers TAL_F1 and TAL_R2

2. PCR with the follow program (see ^{Note 13})

   1. 95 °C, 10 min

   2. 95 °C, 30 s; 55 °C, 30 s and 72°C, 3 min → 30 cycles

   3. 72°C, 5 min

   4. 4°C forever

3. Resolve PCR product in 1% agarose gel and identify positive clones (Fig. 34a)

4. Culture positive colonies overnight 37°C in LB with ampicillin

3.4.3 Day 3

1. Mini-Prep overnight cultures of selected positive clones

2. Verify assembled TALEN by Sanger sequencing with TAL_F1 and TAL_R2 (see ^{Note 3})

3.5 Synthesizing TALEN encoding mRNA and microinjection into 1-cell zebrafish embryos

1. Linearize TALEN encoding plasmid with SacI

2. Purify linearized plasmid by ethanol precipitation and quantify purified plasmids

3. Set up in vitro transcription reaction with Ambion mMESSAGE mMACHINE® T3 Transcription Kit according to manufacturer’s instruction (see ^{Note 14})

4. Purify and quantify transcribed mRNA

   1. Add 50 μL LiCl Precipitation Solution to each transcription reaction

   2. Precipitate at −20 °C ≥ 1 hour

   3. Centrifuge at 4 °C, 12,000g for 15 min

   4. Remove supernatant and wash with 70% ethanol

   5. Centrifuge at 4 °C, 12,000g for 5 min

   6. Remove supernatant and air dry pellet

   7. Resuspend pellet in 50 μL deionized water and quantify mRNA

5. Make working stock for microinjection by mixing and diluting both mRNA encoding the TALEN pair (final concentration ~20 ng/μl of each TALEN mRNA, 20pg × 2, see ^{Note 15})

6. Microinject (20 pg to 100 pg each TAELN arm, see ^{Note 16}) into the yolk of 1-cell embryos

3.6 Examine somatic TALEN activity by RFLP assay or PCR to detect a large deletion

1. Extract genomic DNA from control (uninjected) and TALEN injected embryos (see ^{Note 17}) as described in section 3.2

2. PCR amplify the target locus

3. Digest 10 μL PCR product with appropriate restriction enzyme and resolve digested product on 1.5% agarose gel (Fig. 34b)

4. To detect a large deletion generated by two TALEN pairs, extract genomic DNA from control (uninjected) and TALEN injected embryos (see ^{Note 18}) as described in section 3.2

5. PCR amplifies the target locus with appropriate primers (see ^{Note 18}, Fig. 2) and resolve PCR product on agarose gel

3.7 Screening of germline transmission for stable mutants

For loss-of-function mutagenesis using a single TALEN pair, germline transmission efficiency correlated with TALEN mutagenic activity. Usually founder fish will be identified within screening of 10 injected fishes when working with a moderately active TALEN (~60% mutagenic activity in RFLP assay). In large deletion with 2 TALEN pairs, efficiency is typically 2–5 fold lower, also depending on activity of TALEN pairs. In case of site-directed mutagenesis through HDR, efficiency will be ~100 fold lower and a much larger number of injected fishes will have to be screened for founder.

1. Raise potential batches of injected embryos (siblings showing expected somatic mutation)

2. Genotype juvenile fishes (around 4–6 weeks old) by tail fin biopsy (see ^{Note 19})

3. Extract genomic DNA from fin tissue following section 3.2 and screen with RFLP or PCR assay for maintenance of induced as described in section 3.6

4. Raise juveniles with stable somatic mutations to sexually mature and out-cross with Wild-type to obtain F1 embryos

5. Extract genomic DNA from individual F1 embryos following section 3.2 and genotype with RFLP or PCR assay

6. Raise potential batches of F1 embryos (siblings showing heterozygous mutation)

7. Genotype juvenile F1 as described in step 2–3

8. Confirm mutation carried in F1 by Sanger sequencing (see ^{Note 20})

Figure 3.

(a) Typical colony PCR result after TALEN assembling. Lane 1 is a negative clone with empty GoldyTALEN backbone showing a ~0.65kb band and Lane 2 is a positive TALEN clone showing the laddering effect with a band at ~1.5kb. (b) Typical RFLP assay result of single embryos. Lane1–4 are uninjected control with completely digested PCR product and Lane 5–8 are embryos injected with TALEN showing undigested products (red box). L: Ladder.