Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
| Oligonucleotides | Primer sequences | Position | PCR product length | |
| hTERT | Forward | 5′ CCGCCTGAGCTGTACTTGT 3′ | 2156F | 198 |
| Reverse | 5' CAGGTGAGCCACGAACTGT 3' | 2362R | ||
| Beta-actin | Forward | 5′ TCCCTGGAGAAGAGCTACG3′ | 787F | 131 |
| Reverse | 5′GTAGTTTCGTGGATGCCACA3′ | 917R | ||
