REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
Mouse mono anti-α-tubulin (clone DM1A) – IB	Sigma	T9026; RRID: AB_477593
Goat poly anti-Amylase (clone C20) – IB	Santa Cruz	sc-12821; RRID: AB_633871
Rabbit mono anti-ATG101 (clone E1Z4W) – IB	Cell Signaling Technologies	13492
Rabbit poly anti-ATG13 – IB	Sigma	SAB4200100; RRID: AB_10602787
Mouse mono anti-ATG13 – IB (Figure 2C only)	MBL	M183-3; RRID: AB_10796107
Rabbit poly anti-ATG5 – IB (Figure 2B)	Cell Signaling Technologies	2630; RRID: AB_2062340
Rabbit poly anti-ATG5 – IB (Figure 4I)	Sigma	A0731; RRID: AB_796188
Rabbit mono anti-BiP (clone C50B12) – IB	Cell Signaling Technologies	3177S; RRID: AB_2119845
Rabbit mono anti-Carboxypeptidase A (clone EPR12086) – IB	Abcam	ab173283
Rabbit poly anti-CCPG1 - IB, IP	Proteintech	13861-1-AP; RRID: AB_2074010
Rabbit poly anti-CCPG1 – IF Affinity-purified on N-term peptide	Eurogentec Double X programme	N/A
Rabbit anti-FAM134B - IB	Gift from Ivan Dikic, Goethe University, Frankfurt (Khaminets et al., 2015)	N/A
Mouse mono anti-FIP200 (clone 14E11.2) - IB (Figures 2C and S1A only)	Millipore	MABC128
Rabbit mono anti-FIP200 (clone D10D11) - IB, IF, Peptide Array	Cell Signaling Technologies	12436
Mouse mono anti-FLAG (clone M2) – IB	Sigma	F3165; RRID: AB_259529
Rabbit mono anti-GFP (clone D5.1) XP – IB	Cell Signaling Technologies	2956S; RRID: AB_1196615
Nanobody GFP (GFP-trap magnetic agarose beads) – IP	Chromotek	gtma-20; RRID: AB_2631358
Mouse mono anti-GST (clone GST-2) – IB	Sigma	G1160; RRID: AB_259845
Rat mono anti-HA (clone 3F10) – IF	Roche	11867423001; RRID: AB_10094468
Rabbit poly anti-Ki67 – IHC	Abcam	ab15580; RRID: AB_443209
Mouse mono anti-LAMP2 (clone H4B4) – IF	Abcam	ab25631; RRID: AB_470709
Rabbit mono anti-LC3B (clone D11) XP - IB, IF	Cell Signaling Technologies	3868; RRID: AB_2137707
Rabbit poly anti-Myc (anti-c-myc agarose conjugate) – IP	Sigma	A7470; RRID: AB_10109522
Mouse mono anti-Myc (clone 4A6) - IB (Figures 1B and 1C only)	Millipore	05-724; RRID: AB_11211891
Rat mono anti-Myc (clone JAC6) – IB	AbD Serotec	MCA1929; RRID: AB_322203
Rabbit mono anti-PDI (clone C81H6) – IHC	Cell Signaling Technologies	3501; RRID: AB_2156433
Rabbit poly anti-Rabbit IgG - IP control	Cell Signaling Technologies	2729; RRID: AB_2617119
Rabbit poly anti-RTN3 - IB	Millipore	ABN1723
Mouse mono anti-Syntaxin17 (clone 2F8) – IF	MBL	M212-3
Rabbit mono anti-TRAP alpha (clone EPR5603) – IB	Abcam	ab133238; RRID: AB_11157579
Mouse mono anti-Trypsinogen (clone D1) – IB	Santa Cruz	sc-137077; RRID: AB_2300318
Rabbit mono anti-ULK1 (clone D8H5) – IB	Cell Signaling Technologies	8054; RRID: AB_11178668
Mouse mono anti-ULK1 (clone F-4) - IB (Figure 2C only)	Santa Cruz	sc-390904
Mouse mono anti-WIPI2 (clone 2A2) – IF	AbD Serotec	MCA5780GA; RRID: AB_10845951
Anti-mouse IgG, HRP-linked antibody – IB	Cell Signaling Technologies	7076S; RRID: AB_330924
Anti-rabbit IgG, HRP-linked antibody – IB	Cell Signaling Technologies	7074S; RRID: AB_2099233
Anti-rat IgG, HRP-linked antibody – IB	Cell Signaling Technologies	7077S; RRID: AB_10694715
Goat anti-mouse IgG H+L AlexaFluor 488 – IF	ThermoFisher Scientific	A11001; RRID: AB_2534069
Goat anti-mouse IgG H+L AlexaFluor 594 – IF	ThermoFisher Scientific	A11005; RRID: AB_141372
Goat anti-mouse IgG H+L AlexaFluor 647 – IF	ThermoFisher Scientific	A21235; RRID: AB_141693
Goat anti-rabbit IgG H+L AlexaFluor 488 – IF	ThermoFisher Scientific	A11034; RRID: AB_2576217
Goat anti-rabbit IgG H+L AlexaFluor 594 – IF	ThermoFisher Scientific	A11012; RRID: AB_141359
Goat anti-rabbit IgG H+L AlexaFluor 647 – IF	ThermoFisher Scientific	A32733; RRID: AB_2633282
Goat anti-rat IgG H+L AlexaFluor 488 – IF	ThermoFisher Scientific	A11006; RRID: AB_2534074
Goat anti-rat IgG H+L AlexaFluor 594 – IF	ThermoFisher Scientific	A11007; RRID: AB_10561522
Bacterial and Virus Strains
Rosetta II (DE3) cells	Novagen	71400-3
Library efficiency DH5α competent cells	Invitrogen	18263012
Chemicals, Peptides, and Recombinant Proteins
35mm glass bottom dishes	World Precision Instruments	FD35-100
Anti-HA-agarose	Sigma	A7470
Bafilomycin A1	Sigma	B-1793
CCPG1 15-mer peptide array (amino acids 1-230)	JPT Peptide Technologies GmbH	Custom Order
cOmplete Protease Inhibitor Cocktail	Roche	11140920
Dako fluorescent mounting medium	Dako	S3023
DAPI	Sigma	D9542
DTT	Sigma	43815
EBSS	Sigma	E2888
ECL prime	Amersham	RPN2232
EDTA-free cOmplete Protease Inhibitor Cocktail	Roche	4693159001
EM grade gluteraldehyde	Sigma	G5882
ER Tracker Red	Molecular Probes	E34250
Fluoroshield mounting medium	Sigma	F6182
G418	Formedium	G418S
GluC	Promega	V165A
Glutathione Sepharose 4B beads	GE Healthcare	17-0756-01
High precision cover-glass	Zeiss	474030-9000-000
Hygromycin	Millipore	400052
IPTG	Fisher Scientific	BP1755-10
Lipofectamine 2000	Invitrogen	11668-019
Mass spec grade Trypsin	Promega	V5280
Oligofectamine	Life Technologies	12252-011
Puromycin	Fisher Scientific	BPE2956-100
RNAse-free water	Gibco	15230-089
Trizol	Ambion	15596026
Tunicamycin	Sigma	T7765
HA peptide	Sigma	I2149
Recombinant His-FIP200	Gift from Noor Gammoh, University of Edinburgh (Gammoh et al., 2013)	N/A
Critical Commercial Assays
0.45 μm spin filter	Millipore	20-218
Bond Polymer Refine Detection	Leica	DS9800
Qiagen RNeasy kit	Qiagen	74106
QIAshredder	Qiagen	79654
qScript cDNA SuperMix	Quanta Biosciences	95048
DyNAmo HS SYBR Green qPCR Kit	ThermoFisher Scientific	F410L
Experimental Models: Cell Lines
Human: Human Embryonic Kidney-293FT	Clontech	N/A
Human: HeLa female cervical carcinoma-EcoR	Gift from Ken Parkinson, Beatson Institute, Glasgow	N/A
Human: HeLa cervical carcinoma-EcoR ΔATG5	This study	N/A
Human: HeLa cervical carcinoma-EcoR ΔCCPG1	This study	N/A
Human: HeLa-TetOff GFP	This study	N/A
Human: HeLa-TetOff GFP-CCPG1	This study	N/A
Human: HeLa-TetOff GFP-CCPG1 mtLIR	This study	N/A
Human: HeLa-TetOff GFP CCPG1 mtFIR1+2	This study	N/A
Human: A549 male lung cell carcinoma	Gift from Chris Marshall, ICR, London	N/A
Human: A549 lung cell carcinoma ΔATG5	(Newman et al., 2017)	N/A
Human: A549 lung cell carcinoma ΔCCPG1 clone 1	This study	N/A
Human: A549 lung cell carcinoma ΔCCPG1 clone 2	This study	N/A
Human: A549 lung cell carcinoma stably expressing NTAP-CCPG1	This study	N/A
Human: A549 lung cell carcinoma stably expressing NTAP-CCPG1 mCherry-ER (KDEL)	This study	N/A
Human: A549 lung cell carcinoma stably expressing NTAP-CCPG1 GFP-DFCP1	This study	N/A
Human: Phoenix-Eco	Gift from Kevin Ryan, Beatson Institute, Glasgow	N/A
Mouse: mouse embryonic fibroblast (MEF) Atg13-/-	Gift from Noor Gammoh, IGMM, Edinburgh (Gammoh et al., 2013)	N/A
Mouse: mouse embryonic fibroblast (MEF) Ulk1/2-/-	Gift from Noor Gammoh, IGMM, Edinburgh (Gammoh et al., 2013)	N/A
Experimental Models: Organisms/Strains
Male ES cells: Ccpg1tm1a(EUCOMM)Hmgu	EUCOMM	Clone ID: HEPD0725_5_F09
Male and Female Mice: C57/BL6N-Ccpg1tm1a(EUCOMM)Hmgu	This paper	MGI:5000356
Oligonucleotides
Primers for qRT	See Table S3	N/A
siRNA oligonucleotides	See Table S3	N/A
Recombinant DNA
gRNA vector	A gift from George Church, Harvard, USA (Mali et al., 2013)	Addgene plasmid # 41824
gRNA Atg5-2 21bp of target: TCTAAGGATGCAATTGAAGCC	This paper	N/A
gRNA CCPG1-3 19bp of target: TCTAACTTAGGTGGCTCAA	This paper	N/A
pDONR223 CCPG1 Human CCPG1 1-757	This paper	N/A
pDONR223 CCPG1 mtFIR1 S22A D23A I24A E25A Human CCPG1 1-757	This paper	N/A
pDONR223 CCPG1 mtFIR2 S104A D105A I106A L109A Human CCPG1 1-757	This paper	N/A
pDONR223 CCPG1 mtFIR1+2 S22A D23A I24A E25A S104A D105A I106A L109A Human CCPG1 1-757	This paper	N/A
pDONR223 CCPG1 mtLIR W14A I17A Human CCPG1 1-757	This paper	N/A
pDONR223 CCPG1 mtLIR1 + mtFIR1+2 W14A I17A S22A D23A I24A E25A S104A D105A I106A L109A Human CCPG1 1-757	This paper	N/A
pDONR223 CCPG1 NTD Human CCPG1 1-230	This paper	N/A
pDONR223 CCPG1 ΔNTD Human CCPG1 231-757	This paper	N/A
pDONR223 CCPG1 NTD Human CCPG1 1-230 with internal deletions or truncated from C-terminus, as indicated in main text	This paper	N/A
pDONR223 EV	Invitrogen	https://www.addgene.org/vector-database/2395/
pDONR223 hFIP200 Human FIP200 1279-1594	This paper	N/A
pDONR223 GABARAP mtLDS Y49A L50A	(Behrends et al., 2010)	N/A
pDONR223 mCherry-ER (KDEL)	This paper	N/A
pDEST 15	Invitrogen	Cat # 11802014
pDEST15-GST (empty vector)	(Newman et al., 2012)	N/A
pDEST15-GST-GABARAP	(Newman et al., 2012)	N/A
pDEST15-GST-LC3B	(Newman et al., 2012)	N/A
pDEST15-GST-LC3C	(Newman et al., 2012)	N/A
pBabe BSD mCherry DEST	This paper	N/A
pdcDNA 6x myc DEST	Created by F. Van Roy and B. Janssens, Ghent University, Belgium	BCCM plasmid #LMBP 7212
pdcDNA FLAG DEST	Created by F. Van Roy and B. Janssens, Ghent University, Belgium	BCCM plasmid #LMBP 4704
pEGFP C1 DEST	This paper	N/A
pmCherry-C1-DEST	This paper	N/A
pREV-TRE GFP DEST	This paper	N/A
MSCV DEST IRES PURO	This paper	N/A
MSCV NTAP DEST IRES PURO	(Behrends et al., 2010)	Addgene plasmid # 41033
MSCV mCherry-ER (KDEL) IRES puro	This paper	N/A
MSCV-SV-tTA	(Liu et al., 2000)	N/A
GST-CCPG1 NTD (bacterial) (1-230)	This paper	N/A
GST-GABARAP mtLDS Y49A L50A	This paper	N/A
MSCV NTAP CCPG1 Human CCPG1 1-757	This paper	N/A
MSCV NTAP EV	(Newman et al., 2017)	N/A
p3xFLAG-CMV10-hFIP200 Human FIP200 1-1594	A gift from Noboru Mizushima, Tokyo medical and dental University, Japan (Hara et al., 2008)	Addgene plasmid # 24300
pBabe-BSD mCherry-CCPG1 Human CCPG1 1-757	This paper	N/A
pdcDNA 6x myc CCPG1 Human CCPG1 1-757	This paper	N/A
pdcDNA 6x myc CCPG1 mtFIR1 S22A D23A I24A E25A Human CCPG1 1-757	This paper	N/A
pdcDNA 6x myc CCPG1 mtFIR2 S104A D105A I106A L109A Human CCPG1 1-757	This paper	N/A
pdcDNA 6x myc CCPG1 mtFIR1+2 S22A D23A I24A E25A S104A D105A I106A L109A Human CCPG1 1-757	This paper	N/A
pdcDNA 6x myc CCPG1 NTD CCPG1 Human CCPG1 1-230	This paper	N/A
pdcDNA 6x myc CCPG1 NTD Human CCPG1 1-230 with internal deletions or truncated from C-terminus, as indicated in main text	This paper	N/A
pdcDNA FLAG-FIP200 Human FIP200 1279-1594	This paper	N/A
pEGFP-C1	Clontech	# 6084-1
pEGFP-CCPG1 CCPG1 Human CCPG1 1-757	This paper	N/A
pEGFP-CCPG1 mtLIR W14A I17A Human CCPG1 1-757	This paper	N/A
pEGFP-CCPG1 mtFIR1+2 S22A D23A I24A E25A S104A D105A I106A L109A Human CCPG1 1-757	This paper	N/A
pEGFP-CCPG1 mtLIR + mtFIR1+2 W14A I17A S22A D23A I24A E25A S104A D105A I106A L109A Human CCPG1 1-757	This paper	N/A
pEGFP-CCPG1 NTD Human CCPG11-230	This paper	N/A
pEGFP-CCPG1 ΔNTD Human CCPG1 231-757	This paper	N/A
pmCherry-ER-3	A gift from Michael Davidson, MagLab, USA	Addgene plasmid # 55041
pMXs-puro GFP-DFCP1	A gift from Noboru Mizushima, Tokyo medical and dental University, Japan (Itakura and Mizushima, 2010)	Addgene plasmid # 38269
pRevTRE EGFP	Clontech	# 6137-1
pRevTRE GFP-CCPG1 Human CCPG1 1-757	This paper	N/A
pRevTRE GFP-CCPG1 mtLIR W14A I17A Human CCPG1 1-757	This paper	N/A
pRevTRE GFP-CCPG1 mtFIR1+2 S22A D23A I24A E25A S104A D105A I106A L109A Human CCPG1 1-757	This paper	N/A
pSpCas9(BB)-2A-Puro (PX45) v2.0	A gift from Feng Zhang, Broad Institute, USA (Ran et al., 2013)	Addgene plasmid # 62988
Software and Algorithms
GraphPad Prism 7	GraphPad Software, Inc.	http://www.graphpad.com/
Imaris 8.1	Bitplane	N/A
NIS-Element Advanced Research software	Nikon Instruments	http://www.micron.ox.ac.uk/software/SIMCheck.php
Fiji	NIH	https://imagej.net/Fiji
MaxQuant (Version 1.5.7.4)	(Cox and Mann, 2008)	http://www.coxdocs.org/doku.php?id=maxquant:start
WebMeV	N/A	http://mev.tm4.org/#/welcome
CompPASS	(Sowa et al., 2009)	http://bioplex.hms.harvard.edu/downloadComppass.php
NiS Elements software	Nikon Instruments	https://www.nikoninstruments.com/en_GB/Products/Software/NIS-Elements-Advanced-Research/NIS-Elements-Viewer
Bioformats plugin	Open Microscopy Environment, Dundee, UK	https://docs.openmicroscopy.org/bio-formats/5.7.0/users/imagej/