Molecular structures of miR-7-5p, miR-140-5p, and 202-3p. (a) Pre-miRNA hairpin of miR-7-5p, second structure of pre-miRNA, and, in red, mature sequence: 24| UGGAAGACUAGUGAUUUUGUUGU |46; (b) Pre-miRNA hairpin of miR-140-5p, 2nd structure of pre-miRNA, and, in red, mature sequence: 23| CAGUGGUUUUACCCUAUGGUAG |44; (c) miR-7-5p sequence of target interactions—EGFR; (d) miR-7-5p sequence of target interactions—RAF1; (e) miR-7-5p sequence of target interactions—BCL2 and position in the gene sequence; (f) miR-7-5p sequence of target interactions—IGF1R; (g) miR-140-5p sequence of target interactions—VEGFA; (h) Pre-miRNA hairpin of miR-202-3p, 2nd structure of pre-miRNA, and, in red, mature sequence: 64| AGAGGUAUAGGGCAUGGGAA |83; (i) miR-202-3p sequence of target interactions—IGF1R; (j) miR-202-3p sequence of target interactions–GLI1; (k) miR-1-3p sequence of target interactions—MET. Mature sequence of miR-1-3p: 53| UGGAAUGUAAAGAAGUAUGUAU |74. Pre-miRNA hairpin structure of miR-1-3p is unknown.