Figure - PMC

Skip to main content

An official website of the United States government

Here's how you know

Here's how you know

Official websites use .gov
A .gov website belongs to an official government organization in the United States.

Secure .gov websites use HTTPS
A lock ( ) or https:// means you've safely connected to the .gov website. Share sensitive information only on official, secure websites.

View full-text article in PMC

. 2017 Dec 25;19(1):52. doi: 10.3390/ijms19010052

Search in PMC
Search in PubMed
View in NLM Catalog
Add to search

© 2017 by the authors.

Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).

PMC Copyright notice

Molecular structures of miR-7-5p, miR-140-5p, and 202-3p. (a) Pre-miRNA hairpin of miR-7-5p, second structure of pre-miRNA, and, in red, mature sequence: 24| UGGAAGACUAGUGAUUUUGUUGU |46; (b) Pre-miRNA hairpin of miR-140-5p, 2nd structure of pre-miRNA, and, in red, mature sequence: 23| CAGUGGUUUUACCCUAUGGUAG |44; (c) miR-7-5p sequence of target interactions—EGFR; (d) miR-7-5p sequence of target interactions—RAF1; (e) miR-7-5p sequence of target interactions—BCL2 and position in the gene sequence; (f) miR-7-5p sequence of target interactions—IGF1R; (g) miR-140-5p sequence of target interactions—VEGFA; (h) Pre-miRNA hairpin of miR-202-3p, 2nd structure of pre-miRNA, and, in red, mature sequence: 64| AGAGGUAUAGGGCAUGGGAA |83; (i) miR-202-3p sequence of target interactions—IGF1R; (j) miR-202-3p sequence of target interactions–GLI1; (k) miR-1-3p sequence of target interactions—MET. Mature sequence of miR-1-3p: 53| UGGAAUGUAAAGAAGUAUGUAU |74. Pre-miRNA hairpin structure of miR-1-3p is unknown.