Colony Formation in Solid Medium by the Relapsing Fever Spirochetes Borrelia hermsii and Borrelia turicatae

Abstract

Relapsing fever (RF) in North America is caused primarily by the spirochete Borrelia hermsii and is associated with the bite of its tick vector Ornithodoros hermsi. Although this spirochete was known long before the discovery of the Lyme disease (LD) spirochete, Borrelia burgdorferi, basic methods to facilitate the study of B. hermsii have lagged behind. One important technique to expedite the study of the molecular biology and pathogenesis of B. hermsii would be a reliable method to grow and clone these bacteria in solid medium, which we now describe. We have defined the solidifying agent, plating temperature, oxygen concentration, and pH for the efficient plating of two species of RF spirochetes, B. hermsii and Borrelia turicatae. Importantly, this technique allowed us to successfully isolate virulent, clonal cell lines of spirochetes, and to enumerate and isolate viable B. hermsii from infected mouse blood and tick tissues. Our results also demonstrate the value of testing a range of several environmental variables to increase the efficiency of bacterial isolation, which may be helpful for researchers working on other prokaryotes that are intractable for in vitro growth.

1. Introduction

Borrelia hermsii is the primary agent of relapsing fever in western North America. Being a zoonotic pathogen with a complex maintenance cycle, B. hermsii resides in mammals and its tick vector, Ornithodoros hermsi. Borrelia hermsii was first grown continuously in liquid culture by Kelly in 1971 (Kelly, 1971). Kelly’s medium was further improved for growth of other Borrelia species, including the Lyme disease (LD) spirochete, Borrelia burgdorferi, leading to the currently used medium, BSK-II (Stoenner, 1974; Burgdorfer et al., 1982; Barbour, 1984). Although the medium allows for colony formation of the LD spirochetes (Kurtti et al., 1987; Rosa and Hogan, 1992; Samuels, 1995), to date, growth of any RF spirochetes on solid medium as isolated colonies has not been successful. Currently, clonal populations of B. hermsii and B. turicatae are isolated in liquid medium by limiting dilution (Stoenner, 1974; Battisti et al., 2008; Fine et al., 2011; Lopez et al., 2013; Raffel et al., 2014). However, this method is time-consuming and does not yield large numbers of clonal isolates. Plating for colonies on solid medium would be a more efficient method for selecting and screening mutants and enumerating viable bacteria from the blood and other tissues of infected mammals and ticks. Here, we describe the development and optimization of a method for the efficient plating of RF spirochetes from liquid culture medium, infected ticks, and the blood of infected mice.

2. Materials and methods

2.1. Ethics statement

All animal work followed the guidelines of the National Institutes of Health for the care and use of laboratory animals. Protocols were approved by the Rocky Mountain Laboratories Animal Care and Use Committee. Rocky Mountain Laboratories, NIAID, NIH, are accredited by the International Association for Assessment and Accreditation of Laboratory Animal Care (AAALAC).

2.2. Bacterial strains and growth conditions

Borrelia hermsii strains DAH, a DAH non-motile mutant in fliH (Guyard et al., 2013), and Borrelia turicatae 91E135 (Schwan et al., 2005) were grown in mBSK-c (Battisti et al., 2008), which is BSK-II modified with 6 g/L glucose and 12% rabbit serum (Pel-Freez, Rogers, AZ, USA). Liquid cultures were incubated at 35°C in 5% CO₂ and either 3% O₂ or atmospheric O₂ (18% in Hamilton, MT) in a Forma Series II Water Jacket CO₂/O₂ incubator (Thermo Fisher Scientific, Inc., Waltham, MA, USA) with the caps loosely attached on the tubes.

2.3. Plating of RF spirochetes from liquid medium

The plating medium consisted of a 20 ml bottom agar of the BSK-II plating medium used for B. burgdorferi (Rosa and Hogan, 1992; Rosa et al., 1992; Samuels, 1995) at pH 7.5 with rabbit serum increased to 10%. Bottom plates were poured 1–3 d in advance of spirochete plating and allowed to equilibrate in the CO₂/O₂ incubator at 35°C. A top agar was made with BSK-II, 10% rabbit serum, 1% SeaPlaque Low Melting Point Agarose (LMP) (Lonza Rockland, Inc., Rockland, ME, USA) and equilibrated to 37°C. Borrelia cells were grown in mBSK-c, enumerated using a Petroff-Hausser Counter (Hausser Scientific, Horsham, PA, USA), and diluted to provide a countable number of colonies on the plates (30–300 cells). Ten ml of top agar was added to a 15-ml tube containing the spirochetes and the suspension was poured onto the bottom agar plate. After the top agar solidified, plates were returned to the incubator. The plating efficiency (in %) was determined for each plate and was based on the number of colonies observed, divided by the number of colonies predicted from the microscopic counts. Statistics were performed with GraphPad Prism 6.0 (GraphPad Software, Inc., La Jolla, CA, USA).

2.4. Gel electrophoresis and Immunoblotting

Borrelia hermsii DAH whole-cell lysates were prepared from 5 ml mBSK-c cultures. The cells were harvested by centrifugation, washed twice with Haley’s Buffer (4.77 g/L HEPES, 2.92 g/L NaCl, pH 7.6), resuspended in 150 μl Laemmli sample buffer and heated at 95°C for 10 min. Lysates (8 μl, ~4 × 10⁷ cells) were electrophoresed in 4–15% Mini-PROTEAN TGX gels (Bio-Rad Laboratories, Inc., Hercules, CA, USA). Proteins were transferred to a nitrocellulose membrane with the Trans-Blot Turbo blotting system (Bio-Rad Laboratories, Inc.). Membranes were blocked overnight in TBS-T (25 mM Tris base, 150 mM NaCl, pH 7.4, 0.1% Tween-20) containing 5% non-fat dry milk, then incubated with serum samples collected from mice at 4 wk post-infection (1:600) for 1 h in TBS-T plus 5% milk. The blots were then washed 3 times with TBS-T each for 10 min, incubated with HRP-rec-protein A (1:5000) (Thermo Fisher Scientific) for 30 min in TBS-T plus 5% milk, followed by 4 washes with TBS-T each for 10 min. The blots were incubated with SuperSignal West Pico Chemiluminescent Substrate (Thermo Fisher Scientific, Inc.) and developed on Amersham Hyperfilm ECL (GE Healthcare, Buckinghamshire, UK).

2.5. Quantification of B. hermsii from infected mouse blood

Adult female RML mice were obtained from an outbred colony maintained at Rocky Mountain Laboratories that were derived from Swiss-Webster mice. Two RML mice were inoculated in the intraperitoneal (i.p.) cavity with 500 spirochetes. When the mice became spirochetemic (~10⁷ cells/ml) 4 d post-infection, blood was drawn from the mice by intra-cardiac puncture using a 1ml syringe first filled and then dispelled with heparin (1000 U/ml) to coat the syringe and prevent the blood from clotting. One hundred μl of blood was added to 1.9 ml mBSK-c (1/20) and spirochetes were counted microscopically with a Petroff-Hausser Counter. A series of 10-fold dilutions was made from the same sample and 1 ml of each dilution was plated with 10 ml of top agar. To enumerate the number of spirochetes in the blood by Quantitative PCR (QPCR), two 5 μl aliquots of infected blood were placed into 95 μl of SideStep Lysis and Stabilization Buffer (Agilent Technologies, Santa Clara, CA, USA) and stored at −80°C until QPCR was performed as previously described (McCoy et al., 2010; Raffel et al., 2014).

2.6. Enumeration of viable B. hermsii from infected O. hermsi

Ornithodoros hermsi SIS ticks were from a colony reared at Rocky Mountain Laboratories (McCoy et al., 2010) that originated from ticks collected from Siskiyou County, CA. Unfed adult ticks were infected with B. hermsii DAH as nymphs 3 years previously (Raffel et al., 2014), molted, and had not received another blood meal. Fed nymphs were third-stage nymphs that just fed on an infected mouse. Tick infections were performed as previously described (Raffel et al., 2014) but the nymphs were infected on mice that were anesthetized with 21 mg/ml Ketamine and 3 mg/ml Xylazine at a dosage of 0.1 ml per 25 g body weight. To maintain sedation, an additional i.p. injection with 21 mg/ml Ketamine at a dosage of 0.05 ml per 25 g body weight was given. The nymphs did not become fully engorged. The unfed adult and partially fed nymphal ticks were placed individually in a 1.5 ml microfuge tube and surface-sterilized by washing sequentially in 3% H₂0₂, 70% ethanol, then two rinses of sterile water, each for 3 min. The ticks were suspended in 100 μl mBSK-c medium, ground with a sterile pestle, and the pestle was rinsed with 900 μl of mBSK-c. The spirochetes were plated from the 1 ml suspension in plating medium that contained borrelia-resistant antibiotics (0.04 mg Phosphomycin, 0.1 mg Rifampicin, and 5 μg Amphotericin B per liter) (Antibiotic Mixture for Borrelia, HiMedia Laboratories, LLC, West Chester, PA, USA) to control bacterial contaminants. Some unfed adult ticks were dissected so that spirochetes from the midgut, salivary glands, and the remainder of the tick could be individually plated and enumerated. Each sample was placed into a 1.5 ml microfuge tube containing 200 μl mBSK-c, ground with a sterile pestle, the pestle rinsed with 800 μl of mBSK-c and plated to determine the spirochete load in each tissue.

2.7. Quantitative PCR

The quantification of B. hermsii DAH in infected mouse blood was performed by QPCR with the Taqman Universal PCR Master Mix (Applied Biosystems, Waltham, MA, USA) on a Roche LightCycler 480 II (Roche, Pleasanton, CA, USA) using a Taqman primer and probe mix to the B. hermsii flagellin gene flaB (Integrated DNA Technologies, Inc., Coralville, IA, USA). The primer and probe sequences to the flaB gene were: Primer Forward (AAGTCAGCTGCTCAAAATGTAAAAAC), Primer Reverse (CAGCTAGTGATGCTGGTGTGTTAAT) and the ZEN Double-Quenched Probe (FAM-TTTGCGGGT/ZEN/TGCATTCCAAGCTCTT-IBFQ). To estimate the number of spirochetes per ml of blood, a standard curve was generated as described (McCoy et al., 2010; Raffel et al., 2014). Briefly, 10 μl of uninfected blood and 10 μl of spirochetes from a series of ten-fold dilutions ranging from 1×10² cells/ml to 1×10¹⁰ cells/ml were put into 180 μl of SideStep Lysis and Stabilization Buffer and stored at −80 °C. When thawed, the standards and blood samples were diluted 1/10 in sterile water and 3 μl were used in the QPCR and performed in triplicate.

3. Results and discussion

3.1. Development of a plating medium for B. hermsii

We set out to develop and optimize a method that would permit B. hermsii to grow and produce single colonies on a solid medium. Initially, we attempted to plate B. hermsii using the method developed for B. burgdorferi but these pilot experiments were disappointing. When colonies did form on the BSK-II solid agar, they were very diffuse and recoveries were very poor (<10%). Our thought was that B. hermsii moved through the medium efficiently and therefore would not make a single colony. Analysis of the plating method also suggested that the temperature of the plating medium may affect plating outcomes. Borrelia burgdorferi is often plated using medium that is held at 42–45°C prior to plating (Rosa and Hogan, 1992; Samuels, 1995). Therefore, we modified the protocol for plating B. hermsii by lowering the temperature of the medium to 37°C before plating by using low melting point agarose (LMP). We also included a non-motile flagellar mutant (fliH mutant) (Guyard et al., 2013) to test the effects of B. hermsii motility on colony formation.

Cultures of B. hermsii DAH and the non-motile mutant were grown in mBSK-c with 12% rabbit serum in 3% O₂/5% CO₂. The cells were counted on a Petroff-Hausser Counter and plated in a top agar layer of BSK-II with 12% rabbit serum and 1.35% LMP agarose (SeaPlaque, Lonza Rockland), and incubated at 3% O₂/5% CO₂. With both strains, colonies started to appear 5 to 7 d later and all colonies were visible by 10–14 d. Both wild-type DAH and the fliH mutant had plating efficiencies of ~90% (Fig. 1). The fliH mutant had very small colonies compared to the wild type (Fig. 1.), similarly to those colonies described for a B. burgdorferi non-motile mutant (Motaleb et al., 2000). Motility clearly played a role in colony morphology and spreading but did not contribute to plating efficiency. Perhaps, the lower temperature of the top agar or the LMP agarose itself contributed to growing B. hermsii DAH on solid medium. LMP agarose concentrations tested between 0.83% and 1.35% did not change the plating efficiencies, although in the higher agarose concentrations colony formation was delayed by 1–2 d. Different rabbit serum concentrations from 10–15% had no effect on colony formation. Therefore, we now routinely plate with medium that contains 10% rabbit serum and 1% LMP agarose.

Fig. 1.

Colonies of B. hermsii DAH. (A) B. hermsii wildtype 8 d after plating and (B) a non-motile fliH mutant 12 d after plating.

To determine how long B. hermsii cells remained viable in the solid medium, plates were sealed with parafilm and stored at 4°C or room temperature (RT). During initial optimization of the plating method, we noticed that plates with large numbers of colonies or plates that had been incubated for 14 d began to turn yellow, indicating the plates were turning acidic (Fig. 1 panel A, Fig. 5). Therefore, we not only tested long-term survival of cells on plates at 4°C versus RT but also tested the effects of the acidification of the plating medium on cell viability. Colonies picked from plates that were red or orange but had not yet turned yellow (maximum acidification) were still viable after 1 mo when inoculated into mBSK-c broth regardless of whether the plates were stored at RT or 4°C. However, colonies picked from plates stored at 4°C took slightly longer to recover. In contrast, colonies picked from bright yellow, acidic plates were not viable after a few days. This solid medium allowed B. hermsii to form single colonies, resulting in the ability to obtain a greater number of clonal isolates over the current method of limiting dilution. This technical advance could further the study of B. hermsii by increasing the ease in selecting genetic or phenotypic clonal variants.

Fig. 5.

Plating of B. hermsii DAH from infected mouse blood from four 10-fold serial dilutions.

3.2 Effects of pH on plating efficiency

To further test how pH might affect the plating efficiency, we included another species of RF spirochete, B. turicatae 91E135. This species produced colonies following our new protocol but had a plating efficiency of ~30% compared to ~80% for B. hermsii when grown in parallel (Fig. 2). Borrelia spirochetes experience a range of pH during their enzootic cycle in ticks and mammalian blood. Thus, we proceeded to examine pH as a variable to increase plating efficiencies of B. hermsii and B. turicatae. Both species were grown in liquid mBSK-c pH 7.5 in 3% O₂ -5% CO₂ and plated at pH 7.0, (closer to the pH of the tick midgut (as determined for Ornithodoros moubata (Grandjean, 1984)), pH 7.35 (pH of blood) and pH 7.5 (pH of the medium) (Fig. 3). Borrelia hermsii had a significantly better plating efficiency at pH 7.35 than pH 7.0, but not significantly better than at pH 7.5. Borrelia turicatae had its highest plating efficiency at pH 7.5, significantly higher than at either pH 7.0 or 7.35. Therefore, these results showed that pH can influence the plating efficiency of B. hermsii and B. turicatae but the plating medium at pH 7.5 was adequate.

Fig. 2.

Plating efficiencies of relapsing fever isolates B. hermsii and B. turicatae in 5% CO₂/3% O₂. Data represents the mean and standard deviation from 3 independent experiments.

Fig. 3.

Plating efficiencies of B. hermsii and B. turicatae at pH 7.0, 7.35, and 7.5 in 5% CO₂/3% O₂. Data represents the mean and standard deviation from one experiment. Statistical significance determined by two-way ANOVA with Tukey’s Multiple Comparison Test, * P< 0.05, **** P< 0.0001.

3.3 Effects of oxygen concentration on plating efficiency

The conditions used to culture the RF spirochetes in liquid medium may have significant impact on the plating efficiencies of these bacteria in solid medium. Possibly B. hermsii and B. turicatae had different plating efficiencies due to the medium growth conditions to which they were adapted. For example, we routinely grow B. hermsii in mBSK-c at pH 7.5 at 35°C in microaerobic conditions (3% O₂) because in vivo the bacteria are not exposed to high levels of oxygen. Many labs working with B. hermsii or B. turicatae incubate the growth tubes in a CO₂ incubator with atmospheric oxygen (18–20%) rather than low oxygen (Fine et al., 2011; James et al., 2016; Neelakanta et al., 2017), which was true for our B. turicatae isolate. Even though B. turicatae was passed 2–3 times in low oxygen and achieved similar densities to B. hermsii before plating, it may not have completely adapted to the conditions required for efficient plating. Therefore, we evaluated the effects of O₂ concentration on plating efficiencies for the two species. Borrelia turicatae and B. hermsii cells were grown in mBSK-c (pH 7.5) in 5% CO₂ with 3% or 18% O₂, and then plated and incubated under those same oxygen conditions. Borrelia hermsii had equal plating efficiencies when grown in either oxygen concentration (Fig. 4A). In contrast, B. turicatae had a significantly higher plating efficiency when grown in 18% oxygen compared to 3% O₂ (80% versus 44%, respectively) (Fig. 4A). Interestingly, although more colonies developed in 18% O₂, the colonies took longer to appear. On day 7, there were more colonies on the plates incubated in 3% O₂ while by day 10–12, there were more colonies on the plates incubated in 18% O₂. Clearly, the higher concentration of O₂ increased the plating efficiency of B. turicatae, and indicates that optimizing the conditions is required for each species of spirochete.

Fig. 4.

Fig. 4A. Plating efficiency of B. hermsii and B. turicatae in low (3%) or atmospheric (18%) oxygen and 5% CO₂. Data represents the mean and standard deviation from 2 independent experiments for B. hermsii and 3 independent experiments for B. turicatae (**** P <0.0001 (t-test)).

Fig. 4B. Borrelia turicatae and B. hermsii DAH plated at two different oxygen concentrations of 3% versus 18% O₂ and 5% CO₂. Note the varied colony morphologies at higher oxygen concentrations: black arrow, tight colony, and white arrow, diffuse colony. Plates are representative from 3 independent experiments for B. turicatae and 2 independent experiments for B. hermsii.

Also, plates incubated in 18% oxygen produced a second colony type at a higher frequency than when incubated in 3% oxygen. Plates incubated in 3% O₂ produced mostly tight, compact colonies with an occasional diffuse colony while plates incubated in 18% O₂ had a greater percentage of diffuse colonies for both B. hermsii and B. turicatae (Fig. 4B). We do not know why 18% O₂ triggered these changes in colony morphology, although this may have resulted from oxygen stress or genotypic or phenotypic changes in these relapsing fever spirochetes.

3.4 Colony morphology does not alter infectivity

Borrelia hermsii cells from both colony types were picked and grown in liquid medium and plated again in solid medium. Regardless of the original colony type, a high percentage of the resulting colonies had the tight colony morphology and a small percentage had the diffuse colony morphology. This result is in contrast to B. burgdorferi, which also demonstrated different colony morphologies. When the colony types of B. burgdorferi were picked, grown in liquid medium and plated again, the colony phenotypes were reproducible in solid medium (Rosa and Hogan, 1992; Elias et al., 2002). Whole-cell lysates of B. hermsii from the two colony types showed no major protein changes on a PAGE gel (Fig. S1 panel A). Therefore, to determine if colony morphology reflected a difference in infectivity, 18 colonies (9 tight and 9 diffuse) were picked, grown in liquid medium, and 200 μl of a 10⁻⁴ dilution (100–1000 spirochetes, determined by plating) of each colony were inoculated individually into RML mice. At 4 wk post-inoculation, mouse serum samples were collected and evaluated on immunoblots to confirm infection and to assess any differences in antibody response to the lysates of the two colony types. All 18 colonies were infectious in mice, and sera from mice infected with either colony type were positive and showed only slight differences in antibody response against lysates of both colony types (Fig. S1 panels B, C). These data suggest that distinct colony morphologies are not due to genetic differences because the colony phenotype was not reproducible when replated, and there was no effect on infectivity.

3.5 Plating B. hermsii from infected mouse blood

Borrelia hermsii can achieve cell densities as high as 10⁸ spirochetes per ml in the blood of an infected mammal during an infection. Plating directly from an infected mouse would allow for the isolation of individual clones directly from blood. Also, the number of viable spirochetes could be quantified, especially when comparing spirochetemic levels of viable mutant and wild type cells during the primary infections and relapses. Therefore, we attempted to produce colonies of B. hermsii when plated directly from blood, and to determine if plating was an effective way to enumerate viable spirochetes compared to current methods that are used such as counts on a Petroff-Hausser Counter and QPCR (McCoy et al., 2010; Raffel et al., 2014). Colonies were formed from each of the ten-fold dilutions of blood that were plated (Fig. 5) and the blood did not inhibit bacterial growth even at the lowest dilution tested (10⁻¹). Comparing the three methods of quantifying spirochetes from blood, QPCR estimated more spirochetes per ml of blood than either plating or direct microscopic enumeration with a Petroff-Hausser Counter (Table 1). QPCR indicated 7–8-fold more spirochetes than plating, while the Petroff-Hausser counts indicated about 2-fold more spirochetes than direct plating (Table 1). The higher estimates of cell numbers measured by QPCR likely represented the detection of DNA from lysed and dead cells as well as viable spirochetes. Likewise, direct counting probably detected significant numbers of non-viable, intact spirochetes. The number of lysed or intact, non-viable cells may be more prevalent in the blood after peak spirochetemia. However, the plating efficiency from blood may be significantly lower than the >80% plating efficiency achieved from liquid medium. Nonetheless, plating B. hermsii will produce single clonal isolates directly from the blood, and allow for comparing spirochete quantities in the blood of infected hosts between wild type and mutant strains. Quantifying spirochetes by plating also has an advantage over QPCR and counting cells on the Petroff-Hausser Counter due to the lower limit of detection. The limit of detection for QPCR is 3 × 10⁴ cell/ml and for the Petroff-Hausser Counter is 5 × 10⁴ cells/ml, whereas plating can detect as little as 1 cell.

Table 1.

Comparison of methods for quantifying Borrelia hermsii in infected mouse blood

Counting Method	Mouse 1 (Spirochetes/ml)	Mouse 2 (Spirochetes/ml)
QPCR	2.3 × 108	1.6 × 108
Petroff-Hausser Counter	5.5 × 107	4.8 × 107
Plating (CFU)	3.1 × 107	2.0 × 107

3.6 Plating B. hermsii from infected O. hermsi

We next determined if spirochetes could be plated directly from infected ticks. Seven unfed adult O. hermsi ticks infected with B. hermsii DAH 3 years previously and four 3^rd-stage nymphal ticks that had just taken a blood meal on a spirochetemic mouse produced colonies when plated, with 10²–10³ viable spirochetes isolated per tick (Fig. 6). Therefore, both fasting and recently fed whole ticks were assayed successfully by plating and the number of spirochetes enumerated. Also striking was the finding of nearly 10,000 viable spirochetes in individual ticks that had not fed for three years.

Fig. 6.

Quantification of B. hermsii DAH spirochetes in infected O. hermsi ticks by plating in solid medium. Infected unfed adults had not had a blood meal in 3 years, while the fed nymphs had just received a blood meal from an infected mouse.

RF spirochetes reside in multiple tissues and organs (e.g. salivary glands, midgut, ovaries) in Ornithodoros ticks (Herms and Wheeler, 1936; Lopez et al., 2013; Policastro et al., 2013; Krishnavajhala et al., 2017) and the production of important virulence factors, such as the major outer surface proteins (e.g. the variable tick protein, Vtp) in B. hermsii, are differentially expressed in different tick tissues (Schwan and Hinnebusch, 1998; Raffel et al., 2014). Therefore, we tested the plating method for isolating and enumerating B. hermsii from specific tick tissues. We surface-sterilized 3 infected, unfed adult ticks and dissected out the midgut and salivary glands and retained the remainder of the tick carcass for processing (Table 2). The salivary glands were difficult to triturate because of their small size (< 1.0 mm) and gel-like consistency. Nevertheless, spirochetes were plated and quantified from each of the tissues assessed and suggests that B. hermsii are dispersed throughout much of the adult tick. These findings are consistent with results from Krishnavajhala et al. (2017) that showed B. turicatae spirochetes in the O. turicata tick persistently colonized the tick midgut and salivary glands. We suspect that spirochetes detected in the “remainder” represent spirochetes that had colonized other portions of the tick digestive tract, the reproductive organs, and the nervous system. Therefore, we are confident that this method will allow for the isolation of individual clones of spirochetes from numerous tick tissues and may prove valuable in assessing mutants that may have altered abilities to disseminate within the tick.

Table 2.

Colony counts of B. hermsii from infected O. hermsi tick tissues

Tick	Tissue	# of Colonies	% of Total
1	Midgut	203	22.8
	Salivary Glands	199	22.3
	Remainder	489	54.9
	Total	891	100
2	Midgut	108	70.1
	Salivary Glands	10	6.5
	Remainder	36	23.4
	Total	154	100
3	Midgut	6	9.5
	Salivary Glands	19	30.2
	Remainder	38	60.3
	Total	63	100

4. Conclusions

We developed a procedure and plating medium to obtain isolated clonal colonies of the relapsing fever spirochetes B. hermsii and B. turicatae. Low melting point agarose, temperature, oxygen concentration, and pH were key variables in obtaining high plating efficiencies. This method permitted the isolation of individual B. hermsii clones from liquid culture that retained their infectivity and also allowed enumeration and isolation of spirochetes from infected mouse blood, entire ticks, and specific tick tissues. This technique should further aid in the study of relapsing fever spirochetes by providing an efficient method to obtain clonal isolates when developing and assaying mutants, searching for phenotypic variants, based on various phenotypes such as colony morphology or promoter activity of individual clones with β-galactosidase and fluorescent markers, and to efficiently study environmental stresses on spirochete viability.