Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Primers used to amplify the whole genomes of PCV
| Name | Sequence (5’-3’) | Tm(°C) | Genome position | Size of amplicons | PCV type |
|---|---|---|---|---|---|
| PCV1-F | GGTACCCGAAGGCCGATTTG | 56.5 | 920-939 | 1759bp | PCV 1 |
| PCV1-R | GGGTACCTCCGTGGATTGTTCT | 58.5 | 905-926 | PCV 1 | |
| PCV2-F | GCCAGAATTCAACCTTAACCTTTCT | 63 | 1430-1454 | 1769bp | PCV 2 |
| PCV2-R | GAATTCTGGCCCTGCTCCC | 61 | 1421-1439 | PCV 2 |
