Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Oligonucleotide primers used for amplification of B. subtilis rpoB regions.
| Primer | Sequence 5 → 3′ | rpoB region amplified |
|---|---|---|
| Bsu rpoB-24F | CGCATGATTTGAGGGG | N-cluster |
| Bsu rpoB+737R | GGCGGCTCTCCAGG | N-cluster |
| Bsu rpoB+1319F | CGAATACAATACGCCTCAGC | Clusters I, II, III |
| Bsu rpoB+2000R | CCTGATACGTATTCCATACC | Clusters I, II, III |
